Description :
From Genome Similarity Track
Location :
scaffold_10:263382- 264710
Sequence
1328 bases(100 bases per row)
GCTCCTGTCCTCGCGCTCGCAGCCCACGTGAACCGTTTCATGTGGTCTGCGATGCAAGTGCAAGTGATTTTGCCATCGGTTGTGCGTTGATAcaacacga
tgatgaggATCGAGAGCGATTTATTTCGTATCAGTCGCGACAACTCCAGCCTGCGGATCGAAGCTATCCAATTCATGACAAAGCGCTTCTAGCAATGAAA
TATTATTTGACCAAGTTTCGTGTGTACTTGCTTGGAGAGAAGCGGTttgcgatctatacagatcatgcgttgcTGCGAACGGCTGAAAATACCCCTCATT
TATTGTAGATAATGGCTACAACTTTGTCGTACACTACAAGTCAGGCAAGACAAACATCTAAGCTGATGCGCTGTTAAGACGTTTGAACTACGATCCAAAG
TACAGGAGCGTAAACACGCACGAGTCGTGTCGACAATGCGAAGATTTTCAGACAATCGAAGCGCAAGCAACGACCTCAGTGcgcaaagaaattgtcgaag
gGTACAAGTCTGATGAGACACGTCAGGACTTATTGAGGTATTTCAATGACCCTTCCGACAAAGCCCTGCAAGGTCTTCCGTCTCGGACTAGATCGCGTAT
TCGCGGTTTGAAGTACACAAGGATTTGTTGTGTTTCGCGTTTGAACACGGAGATACAGCAAGAGTTGTTGTTCCAAATGACGATGGTCTCTTATATAAGC
ACCATGACAGCCCTTCGAGTGGCCATCACAAACGTGAGAAAAACTTTTTCGGTCTTTCCCGGGATAAGTATTGGTCACACATTTATTAGTGGTCCGCAAG
TATGTGAGGACTTGTGAGATTTGCACGAGAGTAGAATCATCGGGTTCCACTCTTTCGGTTGTTAGCAGTGCCAACTGACAGCCGAAATTCTGTGAGTATG
GGTTTATATTCAGATTTCCGCGTGACACTCATGGACGCAGAGCCATCCTTGTGTTGGTGGACCGATTCAGCAGGATGATTCATCTTGCGCCTGTTCTGAA
TAAGATCTCGGCCGAAGAGAcagttaaggtctttgtagacgttGGTTTCCGCCTGCATGGTCTTCCTGTTGACGTGTCTGACCGTGACACTCGTTTCACG
TCGAAAGTTTGGCGTGCACTGTTTGGACAATTGGGCATCAAATTGTCCATGTCAACGGCGGAATACCCTGAAATGGACGGTCAAATAGAGCGCTTAAACC
GAGTCCTGAAAGGCATACTGCGTTATGCTTCGTCCTTCAAAAAGTGAAATGAAATTCCCCCTCTAGCAGAGTTTGCGGCGAACAATTTCACGCATGACTT
GACAGGTCATTCGCCATTTTACGTAAAC