Description :
From Genome Similarity Track
Location :
Scaffold_2044:2633- 5821
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_2044-fgenesh-gene-0.0Tetratricopeptide repeat protein

Sequence
3188 bases(100 bases per row)
GACGACTTCCTCGAAGAGCTCATCGGCGTGAGCGCCGCCGCCGTCGTGGACGTGCAGGAGGACCGCGACGTGGTCGTGCAGGAGTGCTTCCTCGCCACGG
AGCGCGCCGTGCTGGAGACCAACAGCGCGCAGGTCGCGAGCGCGCTCGAGAAGCTCCTGGGCGCGGGTGAGGCTGCCGCGACCAGCACGACTGTGAGCGC
GCTCGAGATGGCCAAGCACGTGTGTGAGGGCAAGTACGCCGACGTCGTGCGCTCGAAGCGCGCGCTGCAGCTGCTTAATGCGCTCGCGCAGGCCACTGGC
GTCGCTGCCCAGGGCGACAATGCCGAGGTGCACTTTTGCACGACGACGACCCGGGCGCTGGAGCAGATCCTGCTGCAAGAAGCTGAAGAGGACCGCCTGG
GCGCCGCCTACGAGGTGCTCTTCCTCGGCACAGCGTTCTTCAACATGTACGTGCAGGCGAACTACACGGGCCCGGCCTTCGATAAGGAGCACCTGCGCGA
CATCAACGCGCTCATCGGGCGGCTCTTGTACGGCGACAACGAGCTCGTGGACAAGAAGCTGCACAGCGACGCGCTTGTGGCGCTCCAAGTGGACGGTGAG
AGTCCGTTCTCGATCTGCGAGTTCCCGCAGTTCCTGCTCGTCGGGCGCTGCCTGCTGCACTTTGTCGGCAATGCGACGCACAAGAACTGGTCGTTCGCGA
TCGGCGAGACCGGCACCGAGAGCGCTGCGCAGGACGTGATCTCGTCGCCCAGCGTCGGCCCGGAGCTGCTCGCGCTCTTCAGCACGCTGCGTTCGGCTAC
GTGGTGGAACGCACGCGCGGCGGTGACCCACGAGCGCCTGCTGCTCACGCGCGAGTGCTCCAACACGCTGTGGTTCGAGGCCCGTCGCGGGTTCTTCAAG
GCGATCCGCAGCACGTCGCTCTTCGCGTTCAAACCGTCCGAGTACCTGCGCGCGCGCCTGGACGTCGAGTGGGGGCTCGCGCAGAGCCACTTTGACAAGA
ACAAGCAGGGCAAGCGCAGCTTTGAACAGGCCAAGGAGACGAGCGGCATCACGGCCGAGCTGAGCGGGTCCATGGGCAAGCGCACCAAATTCCAGCAGAA
GGCCACGGCGCAGATGGTGCTCTTAGCCGCGTCCAAGTACCCGCCGACTGACGGCGCGCCGTCCGTGTACGCNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTGGCGGCAAGATGATGCAG
GTCGAGACGGACGAAGAGGGCTTGACCGAGGACGAGAAGGAGATCCAGCGCATGGTGCGCGAGGGCGAGGCCGCGTACCGCGACATCAACCTGGACCAGG
TGGACCAGGACAATATCCTACACGAGCACATCGCGTTCGAGGACAAGTCGCTGACGGAGCAGGGCAACTTGCAGGTGATTGACCAGGTCATCCTGCTCGC
CCTCTGTCTCGACGTGAAAAACAGCAACGCAAACGACGGGCTCACGCGCGAGGAGATGTTCCCGTACATCACGCGCGTGCTCGAGAACCCAAATAACTGG
ATGGTCTACTCGACCGGCCTGCTCGAGCGCGCGTGGCTCGAGTGCGAGACCTCCAAGCGTCGCGAGCGCGCCATCCTGCAGATGCAGGCACTCGTGGACC
AGCACACGACGCGACTCACGGTCACGCAGAACACGCTCAAGTCCATCGAGGACGCGGCGCCGGCGCACGAGCGCATGCAATTTGTACACGCGCTGGCGTT
CCCGCCACGGTATGCGCTCAAGCGTGACCTCGCTGAGCGGTACTTGGCGATCGGCGTGATCCAGTCGGCGCTCGAGATCTTCGAGGAGCTCGAGATGTGG
GACGACGTGGTCAAGTGCTACCAGATCCTGGACAAGCCACTGCGCGCTGAGAAGCTCATCCGCGCGCGGCTCGAGGTCGTGCCGACGCCCTACATGTGGT
GCTGTCTCGGCGACGTGACGCAGGACTTTACGCACTACGAGACGTCCTGGGAGCTCTCCAAGCACCGCTTTGCGCGCGCGAAGCGATCGCTCGGACGTCA
TTACTTTGAGAAGGGCGAGTACGAGACCGCGATCGCGCACTACAACAAGAGCGTCGAGGTGAACCCGATGAACACGAGCGCGTGGTTCGTCATGGGCTCC
ATGAGCATGCGACTGGAGAAGTGGGACTTGGCGCTGCGGTCCTTCACGCGCGTGGCGCAACTTGAGCCGGACAATGGCGAGGCCTGGGGCAACATCGGCT
CGATTCACATGCGCAACCACCGGTACTCGGAGGCCTTCTCCGTGTTCCAGGAGGCGCTCAAACAGAAGCGCCATATGTGGCAGATGTGGGAGAACTACGC
CGTGTGCGCCATGGAGACGGACAAGTTTGGCGAGGCGATCTACGCCATGCACCAGCTGCTGGACCTGCGTGGCAAGCACAAGCGACCGATCGACCACGAA
GTGCTCGCGTGGCTCGTCGAGGCCATCGTGTACCCGGAGCAGTACAAGACGCTCGTGGACGACCTGCAGGATGCGGCTGACGAAGCGAATGCCGTCGACC
TGGAGCTCGAGGGCGACGAGGACGTCGTGGAGGAGGAGGACGACATTGCCGACCTAGACGAGGCCATCGTGGCCACCGACAAGACGCCGCCGCGCTCGAA
CTTTAACTTCAAGAAGCAACTCGCGCTGCTCTTCGGTCGCATCACGTCCATCACAACCAACAACGCCAAGATCTGGCAGATCTACGCACACTTCAATGAC
GGGCTCGCGCGACAGGAGAAGGCACTGGACTGCCGCCTCAAGCAGTGCCGCGCGCTGCAGAGCGCCGGGTGGGAGCAAGACCAGGTGCGCGTGCAGGAGC
TCTGCAAGGCCGCCGTACGACTCTCGGAGGATTACGTGACCGAGGGCTCCAAGAAGTCGCTCTACGCGTGCCGACTGTACATCCGCGGCGTGTTAAAGAA
GGCGCAGGTCGACTACGCCGCGCTCGAGGACGTGCAGGTGCTTGCAGCCACGCTCGAGCAGGTCAACGAGCTAGAGAAGCAGCTGTAG