Description :
From Genome Similarity Track
Location :
contig_25:26329- 27761
Transcript NameFunction/comments
g5773.t1hypothetical protein

Sequence
1432 bases(100 bases per row)
TCATCTTGAGCAGCAACCTTAAACTGGTCCGCTGCATCGATGAATTTCATTGCGGCGAGTTCCTCGTAACTCAGCCGCGTCATCTCCACAAATTTGCGGA
CGCGCATGTCGCGAGCTAGCTTAAGCACAGTCACTCCATCTGGCGACTCAACTGTCTCGTCGTCAATAATGTTGGCGTTGAGTTCCGAGTCGGACGTCAT
ACTGCGACGATTCCAGTTTGCGGATCCCAATGAAACGTACACATCGTCGATGAGGACCAGTTTAGTGTGGACGTAGATGTCGAGATCCTTCTTAGTGGTG
TAGATTTGCACCTTGTTCGGGAACTTCTCCTTCATGGGCCCAATCATCTCGTATAGGTACTTTTCGTATCCTGAGGCCTTGAGAAGAGCGTCAGGTGGCT
GTACAAGTACGATGAGACGCTGGATTCTGGGCAGGACTTCCATGAGTGCATCGAGGAGCTCAGGCACGTAGATGAAGTACTGGTCTTCGATATAGATGAA
GTTCTTGGCATTTCGGAGCGCTTTGAGACGAGCTTTGAAGAGGGACTGTTCTCCACGTGGCGCGAATTCCTTATAGTGCTTATAGGTACAGCTGAAGGTG
CGCACAATTTGGATATTTTGGTTGCCGAGCTTTGACGATGTATTGCTGCTGGCGTAGTCGATCGGCGGCAGCTTCTCGTAGTCCGGATTGTCGAAGCTGA
GCAGGTCGTCCTCGAGTCCCTGACACGGTTTGTAGTCTGAGTTCCAGCGCTGGAGGAAATTGTTGGCCACTTCCTTCGATGCCGGCCCGTGGATCCTAAA
GTGCGCGTCCATCCATCCCTTGTTGCGAAACGGGATGTTGGCGGCTTCACGGATGGCCGTGTTATTGTGGTAAATGGTGTCCCATCGATCGTTGGTGAGG
TCAATGCCGCCAACGTAAGAGATGGGGTGGTCGTCTTTACCAGTCGACTTGTTTGCTGCGATGACAATCGTTTTTTGGTGGTGGGACGATGCAGCTAGCG
GAAGTCGGTCGTCGAAGAGGTAGACAGCCTTGGCTCCGTTAACTTTGGACGGTGGGATTTCGTTGATGGCGTCGCGCGCGTTGGTGTTCTGAGACGTGAG
AAGAAAATTTGGCCACGACAAGAGGTTGACACTTCCACCACGCTCGACGATGCCTTTGAACATTACGTCAAAGCCTGTCTTGGCGCCTGTAGGGTCGACG
TCAGCCTCAAATGGAATGACACAAGTATCCCAGCCTGTATACATGACGCGGTCGCCCTCCTTCGTGGCCGAGAAATCGTCTACCACTGCACTGAAGAATT
CGTTTGCCGCAGTGTAAACCGTAACATTGTTGCCGGTCGTGTACGTCTGCAATCCATCACGTGGGACACCCGCGCGAGTCGACAATGTCTTCTTCGTGAA
TGAACCAGTCGGTGGCTTTGAGGAGAGGTTGG