Description :
From Genome Similarity Track
Location :
Scaffold_33:263254- 271348
Transcript NameFunction/comments
Physo_134675reverse transcriptase
Physo_134676pol protein

Sequence
8094 bases(100 bases per row)
GTACCAACCTATAAATACATTCAGTCTTAGATCTACCGCTTTTCAAGTCAAGTCGTCCCCTTCAGACCAGGGACACGTGAACGGCTGTTCACTTGGAGTT
TGTATACTCCTGCTTCCTCTGTTAAGAAGTGCTGTGTGCCCCGTCACACTTGGTAGCACTTGTAGTCAATCCTACGCCTACGCGGGTAGATTGGACTACC
TGAATTCTTTGTGGTCGCATCGAGTGAGCCAAGATGGATCGGACGGAGTTTCCTCATCTGAGCGACTCGCAGTACGAGTCCGTTCGGAAGATGGCAGGCA
TCTTTGGGACAGATGCCCTGTGTAGCTTAGCGGCGGCGACGCCGGCTGAGCAGGTTGAGCGTATCAACGCATTCGACACCTACGAGCGAGGGCTCATCGC
CCACGTTCAAGGGCTGCAGGCCACTGCGGCCGCGCCGAAGCCGGTGCAACCGAAGCTCCTGCGGCTGAAGGTTCACCCCTTCGAAGGGAAGGAAGGAGAA
AACCTTCACTTCTGGGTTCGAGAGGTTGAGCTCGCGATGGACGCGGCTCTCGTCTCGGACGAGCGACTCCGTGTCGCCTTTGCGCTCTCCAACCTTAGTG
GTCGCGCTAAGAGTTGGGCGTATACGCGCGAAGCGACGACGCCTGGATGCTTCGCATCATGGTCCCAGCTGTGCGAGCAGCTGCGGGCCGCGTTTCTTCC
GGCGAACTACGAGTACCGCCAGCGTTCGCGCTTCCTCGCCTGCAAACAAGGAAGGTGCGAGCTGCATGAGTACATCCAGGAGATGCGAGTGCTCACTGCC
TCTTTGGTGGGGAACCCCCTGCCTGAGCACATCAAGGTGACCGTGTTCATGGACGGTCTGCGTGTCGGTCCTGCCCGCACGCAACTGTTCCGTGTGCAAG
CAAACACTATGGAGGAGGCGATTCAGATCGCTCTCCAGGAGGAGTACAGCCACAAGCAGGCTCATACCCCCGCCACGGTATGGCAGAGCAACCCTGCCTC
TGGCGGTGCGCCTAATGGTAACTCCGGCAATGGAGCGATCAACGGGCCGGTTCCCATGGATCTGGGCATGGCCGAGCAGAGCGACATTCGCTGCTACGGC
TGTGTCAAGCTTGGGCACATGAAACGTGCTTGTCCCGCGGGAGGACTGAAAAAGAAGTTCTCTTCGAAGCCCTTTGGCTCTAGGGGTCGCTGGCAGAAGC
CGCGCCCCAGGAACCAGGGGAACGCCGGACACCGGTAGGGGCGGGGCGCCCTACTGGGGAAACACTAAGTCTTCATGAGGGGTGTGCGGGTGGCGCACGC
CATGGGGACTTAGCCCCTGAGAGTCTCTGTACTCTCGAAGCGGAGAAGGGCAGCGGTGGGCTGCTTGTGGTGCACGCGAGTGTACCGGGATACGATCATC
CCTTGAGAATCTTGATCGACTCTGGGGCGTCCAAGAACTTCGCGCGCCGCCAGACTGTCGCACGCAATCGCGACAAGTACGCCGATGCGCTACGAGGCAG
CAAAGGCAACGGGCTGGTCTCGGTAAGACTGGCCGACGGTACGGTGGTAGAAGTACCTCGGGTCCACATGGACCTCACTGTCAAGTTCGAGGACTTCGAC
AGCACGGAGCCGTTCTTGGTCCTAGACATGGACAAGTACGACTTGATCCTTGGCATGCCGTGGCTGGAGAAACACGAGCCTTGGATCGACTGGCGCGGCA
AGGCCATCGGGGCCAGCCGTCCCTCACGCTCTGACAGAGCTTTGGTGAGTCATGTTCCCACCTCTGGCAGCAGCTGGGGCGCCCGCGACGGCCGCCAGGG
CGCAGCAGCGTCTAATGAGTTCTTGGGTCCGTCGAGACTTACGACGACTCCGACCGGGCCGGACAAGGCCTGAGAGTGGAGGTGCCGGACAGAACCTACC
AGGTGGGTAACGTAGGTCCACACGCGGGTAGCGAAGTACCGCAGGCAGCAAGGGCTGCTGGAGAAGGCGCCGCTGGCGTTGGCGTGGGTAACCAAGTTCC
ACGCGAGGTCACTCAGACCGTAACTGATGAGGAAGGCACTGCAGGTGCTTCCGATGTGGGTAACATAGTTCCACAGGAGGTCACTCAGACCATAACTGAT
GCGGGAGTCGCTGGAAGCGCTCCTGATGTGGGTAACCAAGTTCCACACGGCGAGGTGGGTAACATAGTTCCACCCAGCAAGGCGGGTAACCAAGTTCCGC
TCAAGAACAAGGCGGGTAACGTAGTTCCGCACGAGATCGAGAAGATCGGTGGTGCCGTCAAGGCGGCGCCACACCCGAGGGTCACGTCGTAAGCCGGGCC
TAGTCGTGTGGCCGACGACGCCAGTCGCCAGCGACTCCGAGCCTCCAGCCAAGGCTCCAGCCGCCGAAGAGTGTTATCACATCTTCGACGGCGTGACCGG
TCGTCGGGTCAAGACAGGAGCTGTCGAGCTTACAGCTCTGCCCGAGGTTTCAGAGTTGCGGAACCTTGAGGAGCTCGCCATGGAGGACTTCTTGGCCGAG
CTAAAGGCCGGGGAGATCGCAGAGTTGGTTCTCCTCCGACCGGAGTCCACGTCGGCCGAGTTGAACTCGTCCTCGGTCATGGACCAGGAAGTCCTGGAGG
AGTTCCAGAGACAGCGCGCGTCGCGCATGGGCTCTGAGATTCTTAAGAACCCCCGGGACCCGGTGTACCCCTTGGTGAAGGAGTTCGAGGACGTGGTGTC
CAAGGATCCACCGTCCAATCTCCCTCCGGACAGGGGAATCAGGCACGAGATCGATCTCGTGCCGGGCACGAAGTACTGTGTCACGAGGCAATGGCCTCTT
CCCCGGGAGCAGTGTGAAGTCATTGATGCCTTCTTTGCCGCCAAGGCGAAGGCAGGCATGGTGCGGGAGTCGAAGTCCCCGCACTCGACGCCTACCTTCT
GTGTTCGCAAACCGAACGGAAAGTGGCGTCTGGTTCATGCTTATAACAAGCTGAACAGCGCGACAGTGCCTGCGCAGACACCGATCCCGCGCAAGACGTG
TTGCTCAACAACATGGCCGGCTGCACGCTGTATAGCGCGCTGGACCTGGTGGACGGATACTACCAGATCCTGATGCGCGAGAGCGACATCCCACTCACGG
CTGTGAGCACGCCGAGCGGTATGCTCTGGGAGTGGCTGGTCATGCCTCAGGGGCTTTCTAACGCCCCGGCAACGTTCAATCGCTTGGTCACACAACTGTT
CCGACCTTTGCGTGCGTTCACACAGACCTACTTTGACGACATCTTCGTCCACAGCCGTGCCGAGGCAGGCCAGACGGCCATGATGGTGCATCTCCAGCAC
CTTCGACGTGTGTTCGAAGTCATGCGGGCGAACAAGCTGTACGCCAACATCGACAAGTGTGTGTTCGCAGCTGAGGAGATCAAGGTCCTGGGCTGCTTCG
TCAGCAGCGCCGGGGTCCGGGCGGACCCGGAGAAGGTGAAAACCATCGCGGCTTGGCCGCCACCTGGGCCTCGCGCAACCACTTGCGCAAGTATAGTGCA
GGCTACGCCGAGCTGGCACGGCCCTTGTCGGATCTCCTGAAGAAGGATGTAGACTGGCGCTGGGAGCGTCGCCATCAAGATTCTTTTGACGACATCAAAG
CGAGCTTACAGCGCGCGCCAGTCCTGGCATTGCCGGACGAGACGAAGCCTTTCAGCGTAGTCTGTGATGCGTCTGACTACGCAATTGGCTGTGCGCTATT
GCAGGCCGACGATGAAGACCGCGAACGGGTCATCTCGTTCCAGTCCAGGCAGCTCAAGGCAGCCGAACGGAACTATCCAGTCCACGACAAGGAGCTACTT
GCCATGAAGTACGCTCTTGTCAAGTTCCGAGTGCACCTCCTGGGCTCGACGCCCTTTGTCGTTTATACAGACCACGCGTCCTTGCGGACTGCCGTCAACA
CGCCGCATCTCTCACAGCAGATGGCGCGTTGGCTGTCTTTCGTCGCGGAATACAACTTCCGTGTCGAGTACAAGCCGGGCAAGTTGAACGTGCTTGCCGA
CGCGCTGTCGCGCCGACCCGACTACGAGCTTGCTCATATTAGTCGGGTCACGACGGATCTGTATGATCGCATCAGGCTGGGGTACCGAGACGATGCCAGT
CTCGGACCTCTTGTGCGGTACTTGGCCGCTGGCTCGGAAGCCAAGGCCGAGTGGCTCACGCCCCGACAACGTGCAAGGCTGCACCGCTATGAGTGGGCTG
ACGGTTTGCTCCACTATAGGGTCGAGCCAGAGGATCCTCCCCGTATTGTCGTGCCCAACGACGAGGATCTCAAGTACGACATCCTGATGGAGGCGCACGA
CGCTCCATCCAGTGGCCATCTCGGCCGTGAGAAGACGTACGCGTCTGTCTCGCAGATGTTTTGGTGGCGTCACATGTACAAGTGGGTCGCCACCTACGTC
CGTACGTGCGAGACGTGCCAGCGGGTGAAGCCTGCCGGTCACGCCTCGGCACCATTGCAGAGCCTGCAGGTCCCAGCGGACTGCTGGAAGTCGATGAGTC
TCGACTTTGTCTTCGGACTTCCGGCCGATGAGCGTGGCAACACTGGTGTTGTTGCCTTCGTGTGCCGTCTGAGCAAGATGGTCCACTTTGCTCCAGTTCG
TGACACCGTCACTGGCGACGATATCGCTCGCCTGTTCATGGACTGTGTCTTCCGACACCACGGTCTGCCCGAGACCATTATCTCTGATCGAGACCCGCGG
TTCACCGCTACGTTCTGGCAGACGCTGTTTCGCCTTCTCGGCACACGACTGTCGATGTCGACGGCGGACCACCCGCAGACGGATGGCCAGACAGAGCGCG
TCAATCGCGTGCTCGGGGACACGCTCCGCAGTATCTGCGCGGAGATGCCCCGCTCTTGGGCTGATCGCTTGCCCATGGTTGAGTTCGCACTCAACAATGC
GGTACATGCATCGACGGGCTTTACGCCCTTTTACCTGAACGGGTTGCGCAACCCTCAGGTGCCGCTCACATTACGAGGCAGTACCGGGGCTTCGGTCCTA
AGTGGGGGAGAGGCTCGGAAAACCTTTTCCTCCCAAGTCTCGGACGTGAGTCCAGCCGCCTTGCGGAAGCAACTGTCCTCGTTTGCCGAAGACAGGCTGA
ACATAATCAGCAGGGTGCGAGACACCATGGCGCAAGCCCAAGATAAACAGAAGGAGTACTCTGACCGAAATGGAAGAGGAAACATGAACGTGTTTAAGGT
TGGGGATTTATTTCTCCTAGATACTAGAAACCTACCGCTAAACACTGTTAGCTCGGTCGAGAGCAACAAGCTGAAGCACCGCTTCATTGGACCCTTCACG
GTCCTCAGCCGGCATGGCGCGGCGTACACTATAGACTTGCCCAAGTCGATGACGACTCACCCGACGTTTTACGTGGGTCGTCTTAAGAGGTACCATGACC
CTCTGGCTCTGGCTGCCCCGCAGGAAGCGGTGGGTGGCCCGGTGGAGAAGAGTGGTGCTCCTCGAAGCGCGGCGTCGGGTCGCGGTAAGGCGCCTGATAC
GCGCGCTGGTCGTAAGACGGCGCGGCGTACATCGGAGCAGAATACGCAGGGGCCCCGTACGAGCCCTGGCCAAACTGGGCCTGATACGAGTGGGGCTGCT
GCTGCTCCGGATACGGCACGTGGCCATGAAGCTCGGCCCGAAGGCCAGCGAGCTGGTTTCGCAGCGAGTCGTAAGACGACAGGTCGGCTCGACGATCCAC
ACGGCCATGGAGACTGCGAGTTTCTTGATAGAGCGAGGCAACATCCTCACGGAGCTGCTCCACGGCACCAGGCTGACCAGCACGAGCGGCAGCCTCACCA
CCAAGGCCGACGCCAAGCGCGATCTCGAGGACGTACACACGGTCCCGGAGAAGACAAATCTCCTCTTGCTGCAGGGCCACCACCTGACTCGGGGCCCCAG
CATACAGCTGCGCCGCCTCAGGCTCGTAGCCATGGCCGTGCGAGGCCACCGCCGGCCCTCCTTGATCGTAATGGGCAGATCCACTACCACGTGGAACGAG
TCGTCCGGGAGCGGCGGCTCCATGGCAAGCGCCAGCTGCTCGTGAAGTGGAGGGGTTACCCTGAGTCGGATAACTCGTGGGAGCCCGTTGAGCAGCTCCA
GGTAGACTGCCCGAAGGCTGTTGCGATATGGGACGAGAAGCAGCGGCAGCTTCGTAAGTAGTCCTTGGCTTCTTGGCCGATACCCGGGGCACGGTAGCAG
ACGTAGTCGCACCGCGCCCACGCTCTTCACGAGCTTTGGCTCTCGCCTCTTGCTTCAGCTCGTCCATCTTCGAGTGGAGCATGCGCTTGCTCACGAGTAG
AGCGAACTCGATGCGGAGCTCGCGCAAGTCCAGGATAGCGGACAGAGTGCGATCCTCACGGAGTTCTTTGAACTCTTGGTCGGAATACCCTTTGCGCTAG
ATGTAGCGCCAGAAGCGGTCTTCCACCTCGTTCCAGGTCATGTTCTCATTCGGCTTGAACCAGTGGTAACCCCACACAGGATGGAGTCCACCCTTGTCCT
CCGGCTTCTTGCGAAGCGTGGTGAACTCCTTCAGTGTGAGCTTGTGTGGTGCTAGTAGCACACACCGGGCGACTTCAACGTCGCCAAGAAAGAGTGGCTC
TTTCTCAACGAGAGCACGCTCATAGGAACCCCTCGAGGTGTACCCGCCGATAAGGCCAAGAGGAGCCGAGAGCTTCTCCAGCAGCGCTGGCGCACAGGCT
CGGGCGGGAAGTAGCCCTGCGGATACGTGTCGCTCCCGCCTGACGAAGACTCGACAGCAGTCGCGGCAGCCGACTGCCTGGCGTGTGCCCCCGAACGAGC
AGCGTGGTATTGCTCCTGCTGCTCGTCGAGGTCGTTGGAGAGCTCCTTGGGCTCATGGACGGCACCCTCCTCGTCCTCAGAGTCCGAGTCGCTGAACAGC
TTGGAGCTGGAGCCGCGAGGCGACCTGGAAACGGGACGCTTCTTCGCCCTGGCCTCTTCGGTCTTCGCAGCGGCAGCCGCCTTCGACGCTTGGGCACGCT
CACGACCTTGTGCCAGCGTCAGATGCTTGGGTGGCGACACCGCCTTGGGCTCGGAGCCCGCGTCGCTTGACGACTTCTCGGCCATGTCCTCCGTGTCGGC
CATGACGACGTCGTCTTCTTCCGCCTGCTTGCTGTCACCGACGCCGGCGCTGGACTCGACGTCCTCAGCCTCCTTCTCGGACGGAGCCTTCGGGAAGGGC
GGAGAGCTGGGCGCGCTGCTCGCCGCCAGTGCTTCGTCTTTGGCAGCGTTGTCGCTGCCCTCGGGTGAGCTCTCACCGGAATGCACAACCAGCGTGCAGT
TCTCGATGTTGGCCGACCAGTCGAAGGCCGGCTTGGCCTGCTCCGACTGGGGCCGAGAGCTCCCCTCACCACTTGGCGTGGCCTCGGGAGTCTTGCTCCG
ACTCCGAGACCGGCACCCGCCCTCCGGCGTGCTGCTACGGGAGCGCACCGCCTCCTAGGCCGCCTTCGTGGCCTCCATCAGCGCGGACGACTCGTCCTTG
GCCTTGGCCGCCCTGGTCTTCGGCCCTACAGCCCGCGGTTTCGGAGGTGCTTTCGCACTGCGCGCACTGCGCTTTGGAGGCATGCTTCCGGTCGACGTGG
AGACCCTGCGGCTGGCTCGGCGATGCGCCAGTTGCTCTGTGAGGCCCGGGAGCCGAGGCGCCAGAGCTCGCGCCGTTGTCGATGGATTTCGACTTTGCGA
GTGAAATGTGAGTCGCCGGCGTAACGTCGCTCTGATTGGTCGATAAGATCGAATCTAAGTGGGGGAGGATGTAACGGGGTTACATGGAATAGTGACCCTG
TCACTATTCAGGAATGGCTACATCGGTCACTCCCCTGGATAGTGACCCATGTGGCCTCAGAGCCAACAGATACATTTTGTATGACACAAACTATAGGGAA
CTTAGGATTTGTATGCAGGCCAAATCTGTACCAACCTATAAATACATTCAGTCTTAGATCTACCGCTTTTCAAGTCAAGTCGTCCCCTTCAGACCAGGGA
CACGTGAACGGCTGTTCACTTGGAGTTTGTATACTCCTGCTTCCTCTGTTAAGAAGTGATGTGTGCCCCGTCACACCTCATGTCAGTCGCCAAT