Description :
From Genome Similarity Track
Location :
Scaffold_315:26318- 29977
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_315-fgenesh-gene-0.13Methionine aminopeptidase

Sequence
3659 bases(100 bases per row)
CAGCAGTCGCTAGAAGTGGTCACGAATGAGCGTGATGTGGCGGAGGCGCGCGCGGGCGAGGCCCTCGAAGAGATGGTGGTGCTACAGAGTCAAGTGGAGG
CTGCCATCAAGCAGACTCGTCAGTTGGAGACGCAAGTATCAGCGGCACGTGGCGATCTTCGAGGCAAGGATGCCAAGCTCCAGCTGCTGCGAGACGCGAT
CGTGAAGCTCAAGGAGGAGTTTCTCAAAGCTGAGGACCGTCATGCTGTCGAGCTGGCCAAGGCTCAGCACGCGCTACAGTCGGCAGCGATGCGAGCGCAG
ACCAGGAAGAAGAAGGAGGAAGAGCAAGAGGAGGCGGAGGCGTGGAAGGATGAGAAAGAACGCTTCGAGAGTCAAGTGAAGATGCTGCAGGAGAAGTTGG
CGCTGCAGCGGAAGCAGTTGGCCACAGCTCGGAAAAAGGCATTGAGCAAGCAGACAGCACGTGACGACAGCGACGATTCAAAGCCTTACGATGCGAAAGA
CGCTGAGAGAGATGTGCGTGCAGCCGCTGCGGCAGCTGCTGGCGAGTTGGAGCGGCTCAAGCAGAAGCTCAAGGAGCAGGCTGTAGGCGAGGCGCGTGCA
GTTGCTGAGCTCGAGCAGAAAGTGAAGGTGCTCCAGGCGCAGAATTTGGCGCTGCGGGAGGCGTCGCGTCCACTGGCGGCGATAGTGAAGGCTGGCGCTG
AGGCTGACGGCGAAAGCGAGGCTGACAAACGCGAGCGTCGATCACATGTGGAGATGGAGCGGAAGCTGCAACGGCGTGTGGACATGCTGACGTCACGACT
CAAGGACCAACAAGATGCGCGAGCAGCATTGGATCAAGAGCTGGCGGCAGCACGTGATCGGATCGCGAGTCTTGAAGAAACCGTGCGGCGGCATCAACGA
CAGACTGATACCAAGGTTGATGTCAAGTGGAAGAAGACGGCAGCAGAATTGAACGAGTGGCAAGCGCGGGCGACAGAGCTGGAGCGGCAGAACGCGTTCC
TGCAGGAGACATTGGCACTCAAACGCCGCGAGTGGGAGGACACAGCGCGCGAGCAAATTGAGCAGCACGAGGCGCGCTTCGGACGCTTGTGGACGCGACT
CGTGCGTGTCGGCGTCGTGTCTGCGCACGACGACCCGGATGGCGACGATGATGACGACGGTGCACTAGTCCGTGAAGAATCGCGAGCAGTTATTTCTCAG
TCGTTGCACGATGAAATGAGCGCGCTGAACGCGGAGCTGCTCGATGCTGAACAGCAGGCGGCTGTGAAGGACTCGCGGCTGCTGGAGCTAGAGCTCGAGG
TGGAGACGCTGCGTATCGAATGCCAGCGCCTGCAGCGCATGCCGGCATCGAGTCCGAGTGGAGCTGCAGCTGGCAGGAGCAAAGGTGGTGCTCCAAATAC
CCGCACTGCGCGTGGCGGTACGGCAGGAGTGGGGTGGAAGGAGCGCGCGGAGCTCGAAGACGTGATCGAGAACATGAAAAAGGTGATCGAGAAGCTTCGC
GCTGAGAATGCCAAGTTGCGGCAGGCGTCGACAGCATCCGTGACTCCCGACAAGCTCGCGAAGATGCGGCGTCGAGTGCGAGAGCTGACGGATGCCCGCC
AACAGATGGAGGAGCAGGTAGCCGCGCTCGAGCGCGATGTGAGTGACCTTCGGCAGGACAAGTCACGACTGCAAACCAAATGGAGGCAGGCGGCGACAGC
CTCAGCCGACAAGGAGCGATCGTTGAAGTCGGCGCAAACCGAGATCGCGCGCTTGGAGGCGGTAGTGCAGATGTTCCGACAACGGCAGGAACAACCGCAG
AGTGATGACCGACACAGCGCAGGAATCGACGCCGAGCAGGTGGAGCAGTATGAGCGACAGATCCACGCTCTTGAGGAGCAGGTGGCGTCGCTCGAGGACG
AGAACGCACGGCTGGCACGCGAGTTGGCCGCCTTCGACGACGAGTTCTTCGAGGAGATCGAGGACCTCAAGTACAAGTATGCACAAGCCGTACGCGCCAA
GCGTACGCTGGAAGCTCGACTGCGGTCGCAAGGCGTCGAGAGAACGTGACGACGCCGTGCCCAACCCATTGGAACGCAAGTATTCATTGATTGACACATC
GCACTCCTGCCGACTACAAGTCTGGACGACGACGCTACTAGTTCCAGCGCCAAGGTGCTCAGTAGTCATCGCCGCGCGAGAGGACCTCCTTGCACGTCGG
ACGCAGGATGATTGTGTGCTCGTACTGCGCCGAATAACTCCCCTTGACGTCGACGAGCGGCGGGTACGCCGTCACGATCCCCGTGTCGACGAGGTTCTTG
AGCGCCATGAGGTACTTCTCCTGCTTGGCACCCTTCGGGTTGATAGTAGCCGACCCGCCGTCCTCGCGCTCCAGCCAGCGACGGCAGAATGGCAGCGTGC
CGAACGTGCGCGTCAGGTGGGCGAGCAGCTTCTTGGCGCGCGGCAGCCGCAGCGGCACGTGCGGCGCGTCNNNNNNNNNNNNNNNNNNNNNNNGTCTTGG
CGTAGTGCGACACCTCGCCGTCCTCGACGACGTGGCCGCGACCCGTGGAGCCGAACGTCTCGATGGCGAAGATCTCGCCCTCCTCCATCTTGGTCGGGTC
GCCGCTCTTGACGATCGGCACGCTCTTGCCGGCGTGGATCTGGTACGGGCCGATCGAGTGGCCGTTCAGGTTGCGGATGCTCTTGACCGGGTACGTCTTG
CCCTCGATCGTGACCTCGTACGACTCCATGACCTCCTGGATGGCGGCGCCGATCTCGCCGAGCTGCGCGTCGATGCCCGCGTGCTTGACGCCCTCCTCGG
TCGCCATGCGCGCGGCCTCGAGCAGGTTGTCGAACTGCGGGTCGAACGACACGGTGAAGGCGCTGTCGATGATGCGGCCGTCTACCTGCGTGCCGAAGTC
GAGCTTCATCACGTCGCCGTACTTGAGCACCGTGTCGTCGCCCATGTTCGGCGTGTAGTGCGCCGCCACGTGGTTGAGCGAGCAGCCAGTGGGGAAGCCG
ATGCCGCGCTGCAAACACACACCAACAACACGCCACAAGGTCAGCAACCGGAGTCATGCGATCTTCAATGGCCCAGACATCCATCACACACCGCGAAGCC
GGCCTCCTCGACGAGCTCGCGGTTCTTGTTCTCGAGCGCTGTGCACATGTCGATGAGCTTGATGCCCGGCTGGATCATGCTCTGAGCGAACTTGCGCACG
TGGCGGTGCACCTCGGCGGCGTAGCGGACCTTCGAGTACAGGTCCTCCTGCGCGCGGTCGAGCGCGCGCTTCTCGTCGCTCGTCGTGCGGAACGTGTTCC
AGTCGCCAGGGTGGTCCTGGATCTCACCCTGCGGGAAGTCGCCGTTCGGGAAGAGCTTGGCGACCGGGATCGACGGCGGCTCCGTCTGGCCCACGGCCAC
GTAGCTGTCCGTGAAGCCCGTGACGCCGCGGAACGGCGGCAGCTTGGAGCCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTCGCAGCCTTGGCAGC
CTTGCTCTTCTTCTTCTTGTGCTTCTTCTTCTTCTTCTTGGCCGCCCCAGACTCATCCACCGGCGAGTTGCCGTCCACCTCGTCCACCTCCACGTCCTCC
TCGACGTCGTCCGCGTGCGGCGCCGCCGCCATTTGCTCCTCGAGCTTCGTCATGGTCGC