Description :
From Genome Similarity Track
Location :
Scaffold_29:263139- 265352
Sequence
2213 bases(100 bases per row)
AATTCTAGGCTGCTGTGCTGCCATCTCTTGTCAGTGATCTCCAGCGGCTGCAAAAGTCCAGCCGCTTTGCCTCGTACGGCTTTGTTGCGTTGACATAACT
CGCAAGAGGCTCTATAGCGCTCAACCGACCCAGGCATGCCCTTCCAGTAGGTTTCTCGAGCAGCAGCAGTAGCGTCTTCGCTTGACTAGGATGGCCTCAA
GTGGGGACATCACAGGGGCATTTTTGCGTAGTCGGAAAAAGAGAAGCCCATCTTTAAATGTGAATCTACGAAAACGGCGAAATGGTAGAGGGGTATCAGT
CGACAGCTCACGTAAAATAGGACCGAAGAAAACATCTGTCCTGTAGCCCCATGCGGCAAGTGTCTTTGATGTCCGTCGCTTCAGCTTGAATCTGCAAAAG
TTGTTCAGTCGCATCTGAAGCGTCGGTGTTGGCTAACGCGTGAAGCAGCGATGACAAGCTAATATCCCGGTCCGTCCCGTCGTCCCAGTCGTGACGACTT
GAGATTGCGTTCGCAATGATATTAGATTCACCAGGTACCCACTTAATTAAATGCTGGAAAAGTGCAAGTTCATTTAGCCATTTAGCGAGACGTTGGGAAC
ACTTCTGTTGTTGCAAACTGCTTTCGAGCATGTGATGATCGGTGTTATAGTAATGAAGAAGGGTCGTTCGAGTAAGTATATCTTCCACGTTCGCATCGCA
TAAAGGGGGGGGCAAGTAGTTTCTCTTCGTATGCTCGGTACACCATCTCTAATTTCGAGTGTTTGCGACCGCCGCACGCGATTATTTTCCGGTCCCGTCA
TCATCAAGCTGAAAGAAATATCCACCGCTTGCGATGTCAGAAGTGTCCACATTCACATGAAACGACTTGAAAATTCTGGATGAGCGAGAACTGGCGGCGA
TGTCAGCTTCATTTTTAAAATGTTGAATGCGTCGAGCTGCTGCGTTGTCAGGGAAATGAGGTCACGTAACGTGTTCCTTTAATGATCTCTGTCAATAAGG
TCACATACTTAAAAAAATCTGGGCAGAGTCGCATCACGTAGACGCAAGTACCAATGAAAGATTGCATGTCCCGCTTAGTCTTGGGTACTGGTCAGTCTCC
AATGCTCGCACTCTTTGAAGGATCCATGCATACGCCTTCGCGACCGACAAACTCACCGAGACACGGTATCTCGGGCTGGCAAAACACGCATTTCTCAATT
TTAATGAAAGTAATCTCGCTTGCATAGTGTTCCAGCACTTGTTCGAGACCCACCAAGTGATCCGGAATAGAATCGGTCTTCTTGAGCACAAAGATGTCGT
CAAATTAAGTCGGGCAGAACGAGCTGTAGTCAGCAAATATGGAGCATACCAATCGGTTAAGTGACGATAGGCTGCTCGAGATTCCCATCGGTGTGACAAG
ATATTCGAACAGGTCATCTGGGGCTGCAGATTCTGTGTACGGGATCGACTTTTCTGCTAGCCGCACTTGATAAAAACCCCACCGTTAGTCCATAATGGAT
AGAAGCTTTCCTCTTGCCATAGTGCGCAGAATTTCGTCCTTGCGTGGGATCGGATTAGTCGGTACCGTAACCTTAACTTTAAGTCCTCAAAGATCATGTA
CAATTTTCCATTCACCGTTGCGTTTTCGAGCTTGAAATGTCGAAGTGCAATTCGGAGAAGATGATGGCTAAATCACATCTGCCTTGAGCATGTCCTAAAC
CAGACTTAAATGGCGGCCTTCTGCTCCGGTGATAAAGGAAATTGCTTGCGATGAACTGGAGTCGCATCGGCGACTGTAATTGTGGCATCTCTTGACGGGA
TGGTGGCACATCAGGGAGTTTGAAGCGGAAAACACGGTATCTGTAGCGGCGGATTAATGAATAAGCTGGTGTGCCTTCCAGAGATCGCCATGATGCTTTA
GCATTCGTGTTCTCTGACGCTGGAGCCACATAGAAGCAGTAACCGCTGTCTTTTGCGCGAAGTAGTTTTTAATAGCTCGAGTATCTTTACAGCGAGTTAT
CCCTTGACCACCAAAATGCTCATGCTGCAAATAATACTGCAGGAGAGACTCTCTGTCGTCAGCGATCAGAGAAGCTCATATATTCTTCGGTATTCGACGA
TCGGCGACTCGTCGAGCCCTTTGCCTCGGTACACATGGTTTAAACTGTAATGGTCGTTATTGCTAGGGCAGCATTAGCTCCTCTCGCGGACTCAGCTCAC
GTTTCGGCCAATC