Description :
From Genome Similarity Track
Location :
Scaffold_307:26312- 28624
Sequence
2312 bases(100 bases per row)
GCGATGCGCTCTCGCGCAGGCCGGACTACGAATTAGCTCATGTCACGACAGTGACGTCGTCAGTGCCTGACTTGATACGCAGAGCGTATGCACAGGACGA
CATGTGCGTAGCGCTGCTACGGGCTCTTGGGAGCGAAGAGTTAAAAGACTCTGACAAGGAATAGTCTGCGCGCTTACGCGCGAGGCTGCATCGATACTCG
CTCGATGGTGGCCTGCTGTACTACAGCACCAACTCTGAGGATAACCCTCGTGTACTCGTTCCTTATGATGAGGATCTAAAGTATCGATACCTCTATGAGG
TTCATGATACGCCCGTGGGCGGGCACTTAGGTCGAGAGAAGACCTGTGGCTCGGTGAGCTCGATGTACTGGTGGCCCAAGATGTATAAGTGGGTCGGCAC
CTATGTACGCACGTGTGAGACGTGTCAACGGACAAAGTCCGCGCCGAACACGGCAGCGTCATTGGCGAGTTTGCCTGTCCCCAAGGGATGCTGGTAGTCC
ATGAGTATGGACTTTGTGTTTGGCCTTCCCAAGGAAAGATGGTAAATGCTATCACGGCGATCATGGAGTATGCAATGCCGCTAGTCGACGACCGGTTAAC
AGATCTCGAGCGCTACCTATGGAACGGCTCGCTGGATGCAGCAAGCGGCTTCTGGGCGGTCATGATGACCGANNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCCAAAAAAGCCGCTCTAGGGTAATTCCGGGTCTCAGCGATCATATGCAGTTAACTG
CTTGGAAATGTAAACGACGCCAGTAGTCGGCAGATCTGATATCATCGCACTGTGGTGGATTCATGCTGAAAGCCAAGCCCGCAAATGGACATGCGGATGC
AAGGGCAGGAGCAATGTTGAGGGGTTTGAGGTCGGAGACCAAGTTTTATTTAACGCTAAAAACCTACCTACTCATGCAGTGTCTGCAGTCTTCAAAACGA
AGTTAAGACCTCGGTTCATAGGACCGTTTAAGGTCGTGGCCAGGAAGGGCCTAGCGTATACGCTCAACCTTCCGAAGAAGATGCGCACGCATCCGGTCTT
CTATGTTGGCTTGCTTAAGCCATATCAAGACCCTGCTCAGGTGAGCGCGGAGGCGTTGGCACCAACGGTGGCTGGACCACGGACAGCTGCAGGGCAGCAA
GTGGTGGAGCCACGGGAGGCTGAACGACAGCAAGTGGTGGATCCACAGATGGCTGATCAACAGCATGTGGCAGAGCCACAGGTCGCGGAGCGAAGTGCTC
GAGATGCAGGAGCAAGCCAAGCTGAACGCTCAGCCGAGCGACTGAACGCTCAAGGTCCGAGACCTGGTTGTGAGTCACCAGTGGTGGCTCTAACCTATCC
ACAAGGTGGATCATCTCTTCGAGATCGACCGATGGGCGGTGAACGTGAGCGTTCGCGTCGTGGACGCCGGCGTCGTATGGACGCAGAGGCCGTTCCGGCA
AGTGCTGACTCTCCCCGCGAGAGCCCAGCTGAGGCAAGGCCTCCTCCTGCTCTGCTCGATGAGCATGGTGAGCTTCACTTTCACGTGGAACGCCTTGTGG
CGTGGCGTAGACGCCAGGGTCGTACCCAGTACTTGGTGAAGTGGAGGGGTTACCCTCACTCACAGAACTCATGGGAGTTTGAGGTTATCCTCCGGCAAGA
TTGCCCTGACGTCGTTGACGCTTACGACCGGACACATCATGTGCCGAAGCGCCACCAGGCGCTGGGCGTCTCCCACTAGCGTGGGGAGCGATCAGGTCAG
TAGTTGAGCTCAGGCTCTGACCAGTGGCTGCAGCAGCCAGCTCGTACGTATGAGCGGTGCTCGCAGCGGGAGCAGGAGGTGGAGAGACCTCGTAGTGTTA
GGGACATGGTCCCGAAGGAAGCGGGTGCTTCGTGTTGTGCTGAACAAGTTTCAGGCACAAGCGTCTCGATAGACGCATAGTTGAATTGAAACAACTTGCT
CGATGAGCATGA