Description :
From Genome Similarity Track
Location :
Scaffold_311:2631- 3691
Sequence
1060 bases(100 bases per row)
ACTACACGTTTCATCACTGTTACGGATGCGCCTGCCGCGAGGCGCACCGTCATCTTCGTTGGAGGGATCTCACGCTCAACATATTCGAGTCTCTATTGTC
TAGCGATTGGCGTCGTACAAAGTTGTTCGACGCCCCACAATCGACTAGGGCTCGAAGCGACATGCCTTGTGTCACTTCGAGTTTCAAGGTAATGAGGGAA
ACCTCATTTCCAGAAGCAGCAACACACAATGACTGAGTGTTGGGAGAAACTTTCGTCAAGAGGCGTGCAAACTCACTTGACGTTGCTGGATCAGTATGGT
GCTCCGCACCTACTGACCCTGACCGTTTTTTGGCTGTCCGTTACGTTGTTGCGTTTTCGCAACAACGTCCGACCCACGCCTTGGACCTCACTTGGACGCT
TGGCGGTTACTGTATCATGCAGTACGTGGTACCGCGCTGGGGGAACCGCATTCATATGCGTAATACCCTGTCTTCTAATATCTATTGCATTTCTGCAATT
TCTTGTAGTTGTTAACACGAGAGCTCTCGCTCTCACGTTAAAGAGTTCCATTGGTTCTGGGCCTCCATTTTCCTGTCGTCTCGACAGACGATAGGAATTC
GAATTCGCGTGATCCTGTTTCACGCTGAAGTCCTCCTGTTCCGCAATCTTATTGCCTCTTCAAGGGTGTTGAACTCCAATTGGAACAGGTAGGTTTGAAC
AGGACCATCAGTCAGACCCTGTATGAACAACGTAATCAACGTTTGTTGGTTCAGTGGGTCGACTGTTATGCAACTGGTAAGGTGACGTATGTACTAAATG
TACGAGTGTACATCACGTTTACCTTGCTTGATTCTAAGGAGCTCAGAGCGAGCCCTGAACTCTGCTCGAGGCAGCTCAAAAGTTTGCCTTCGCAGGGACT
TGAAGGCTTCCAACGACCCAAAGACATATGGGTCGTGTAACTTAAGGCCCAAGGCCCACGTCTTTGCACGCCCTACCAAGTTCGATTGAGCAAATGCGAT
CTGCATTTCCTCATCGACGATATGACTAACCCTTATGGCATCGTCTAGTTCCACGAACCA