Description :
From Genome Similarity Track
Location :
Scaffold_68:26307- 29938
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_68-snap-gene-0.23Conserved gene of unknown function

Sequence
3631 bases(100 bases per row)
CACGATGATGCAGGAGAGCCTCGGTGGCGAGTCGTCTGCGAGTGTCAAGCGCGCGCTCGCGAAAGTGCAGAAGATGCTTCAATTGGCCTCGACCAAGCGG
AACGCGCTCGCGCTCAAGGACTATCGCGAAGCCTTGGAGGTGAGTGAAAGATGGAAAGCGTCGAGTTGTTGGAAACTCCATTGAGTTGAATTTTTGCTTG
TTTACTTTATAGGAATGCTTAAAGACGGAGGCGAGTACGATCATGAAGATTCTCGGGTATCGGCTCGCCAGTCGCTGTCCGAGNNNNNNNNNNNNNNNNN
NNNNNNNCGTTCAGCACGTGGCAGTTTTTGCTTGATGCGTGTGTGACCGAGCTCGCGAGTTCGCAAAATGCGCCGATTCTGTTGTACGCGATCCCGCTGT
TGCAGCAAATCCCGCTTCCTCTGTTCCTGGCTTTCTTGATCTCATCCGAGAAAGAGCCCATGAACAAGTTGCGCGCAGTGCTGACCCACGAGCAAAGTGA
TGTGCGCTGTTGCGCGATTGCAACGCTATCGAGGGTGTCGCTCAACGTCGCGACCAGCATCGCGGCTGATGGACTCTTTGCGTTCTCGTTTGAATCTCAT
GAAGCGCGGATTTGCTGCCAGCAAGATCTGTGGATCATCGTGACAGATACGTGGAAAGTGATCTTCCAAGCGCTTTTTCTTGAGAATGAAATGAGGGACG
TCGCAGGCGCCGCGTTCTCCGCGATGCGCATGCTGTTTGTACGAGGTTCGATGTTGAATGCGTTCAGTCTCAACAAGGAGCCTCAGCTGACTCAATCCGC
GATGAACGATGTGATCACGTCCGTGTTCAAAGAGGCATTTCCGCGGATTCTGTCGATCCAGAGTGCTGCAAAGAAGCTCTCGCTAAAACATCAGGTCGAT
GCGATCATGTGGGTCGCGATGCTGCTCTATATGATGATGGAGAAAAGTGGCGCCCGGTGCCCGGGCGTGNNNNNNNNNNNNNNNNNNTACCTCGACATTG
ACGTGATCTCGGACTCCAACCAGGCTGACGACGATGATGAGGACCAAACTAGTTCCTCGACACGGCGGATGCGCATGGACCAACTCGCGAGCGACCTGCT
GGAGTCGTGGATTTGCCCGTTGTTTTCGAAGAAGGCATCCCTCGCGCAATCGACAGCATTGTGTCGAGCCATGTTCCTGCTGCTATCCCACCCGCTTCAA
GAGTTCACACGGCTCAAACGCGCTACGCTGTTGGTGCAGCAGCTGGTCGCGCAATGCTACTACCACAAGAGCTCAGATTTCAAGCTGGAGATGAGTCAAA
TGCTCGTGAAGACGTTTGCATGGGTATCCCCGTCAGAGTGTGATCAACTATTTGTCCGAACAGTTGAAGCCATCAGCCTCATGGAGCGCGAAACGTACGA
CCCAACACTCTTCCTCTTTTTGCACGAATTGATCTAACTTGCTCGTGTAATTTTTTGCTTCTCTGTAGTGATCGCCAGGGGCTCATCCAGATGTTCATGG
ACGCTATCGTCGACCGTGTTGTGCGCAAGCAAGAATTTCTTTTGCTCGAGTCATTATGCGCGAAGGATTTTTTCCGACAGCCTTCAGGGAGTTCTATACT
GGCACCTCGAGCAAATGGATCCCAAGTCTTTCGCTGCCTTGTCCAAGCACTCGTGCTTCGAACTGATCCGTCCGCTGCGAGTTGTGTACAAGTTGCGCAG
TTGATCGTGCTCAAGGCATTTCAGAAACTTTTGCTTGCGAAGAGCAAGCCACTTGGAGGGAGCAATGCATCGCCACAAAACAATCAGCTCTGTTACATCG
CGCTCTTGTCACTTCATTTCCAGAATCTTGTGCACTCACAAGCGCTTTTATTTCGTGAGTCGCTGCAGTTTTTTCAGAATGATATCCAGCGCGCGTGGCC
TCAGATCACAGCGAGTGACGTGCGGATCCAGTTGCTATGGGTAGGCATCCACTTGTCCTCATCTTATCAGGTCGTACCGCCTCAGAAATTACTAGAGCAG
ATTCATCTGGAGATCCAGGAATTGTCCGCAAGCGAGCACGTGAGCGAAATGGCAACAGTCGAGCCAAGCGAGGCGAATACAACATTCGATGATGGGAAAT
TGGGCGGACTTGAGAGTGGAAACTTCAAGGAAACCAATCACAAGACGAGCATCGAGTCTCTAGTTGCGTTGCAGGACTGCATGGCCTTGATGGCGCACAT
GCATCCTTCTTGCGTTGCCGCTCTTCAACAGGAGCATGAGCAGCTGAAGATGCATGTGACGAGTACGGCGTCTGCTTCGTCACTTCAACACCGCATGTAA
GGAACGTGTTGCTGTTTTGTGGAGGGAGGGGGAGGTCAATTTATTGATGAAATTCTGTGTTGTGTTACGTACTCATTAGGATGCAAGAGCAGCTTCATTC
ACTGTCGACAGCAGCACACGGGAAGAGTTTGTACTCGCAGGAGGTGTTTCATCCGTCGCATTTGTTCATGCCACAAAAACATCAAGAGGTCATGTCGAAC
GAAATGCATTCATCGAATTCACTCTTACATGCGGACTCGTTCAATGATGTCGAGCACGAGGCTGTCATTGTCACTGGAAGTGCCGATCCGTTCTCACTCC
ACGTCACGTACAAGCAACCACTTCCTGGCTGCGAAGACGTTGTGACGATCTGTGTGAGCTGTTGCAACCTTACGAACGTGTCACTGAATGACTTTGAGAT
CCACATTCGACCGCTTGGTGGGGTGAAATGCATCGACGGATCCAACGATTTGAAGCTGCGTCTCATGCAAGGAGGCAACGCGAGTGGGAGTCTTCCGTCT
TTTGGCGTGTGGAAGGGTGAGAAGCGATTTCAAGTGCAGGCTTTTGCCCAGACAAGTTTCTTTTTCCAAGTCGTGTTCAACGAAGTAGACTCTTCTGCCG
ATGGAGATGACCAGCCGCAGGTGATCCCGATCCGCTTGTCGCCCTCGGAAAAGTTTGTGCTGCATTTTGATGCGCTCCTACGCTCGCCAAAGCGCCAATT
CGTAACTGGCACGTTTTTTCAGCGCACGTGGCAAAGGTAAGCGCACAACTCCAGCTACGTCTCACGGACATGATTGATACCCGTTCTGTCTCGAGGTTGA
CGAGATGTTATTGTCACTTATGTTCTTCTTGCAGCGCCGAAGCGAGCTGTCGCTTCTCGATTGAGTCGGTGTTGCTCTCTGAACGCACAGAGAAACTCCT
CTCTTTCTGTCAGCGTCTTGTAAAACGTTGCTGCGCTCGAGTCGCTATCATTCAGGATCTACTAATTGACACTCCGATCCAGACTCACGTAAGTTGTCCG
CTTTCTTTCTGTGCATGTTTGAAGAAGCGACAATGGAGTAAAGCTTGCTTGTTTGGAATGCCTCACTGACTTCATGTTTGCATTACGTTCGTATAGATTG
CGTTCTTGACGGAGACACGATGGGAGCAGTTTGTTGCCGCGTCTGTGACATTGACTGCTTCCTGTGGTGCACCTGCAGAGGATTCCGCCATGCATGCACG
ATGGTCTGGCGTGCTGGAGATCCGTTCGTCCAGCGCCAACATCCGCGAGTTTGTCAAGGCGCCACCGGATGCGTTGCACGTCTTTTGCGGCCACCAACAT
ATCCAGATCGCGTCCGATCTGTCTAACAGGA