Description :
From Genome Similarity Track
Location :
Scaffold_85:26302- 28401
Transcript NameFunction/comments
Phymu_g3835hypothetical protein

Sequence
2099 bases(100 bases per row)
AACTCGCTAGTGTCCGAGATCGAAATCGAGGAGATACTTGAGGCAGCGGAGGCTGTGCGTCAGGAGTACCATGACTCGACATGGGAGCATGTCAAGATCG
TCACtatgctgctgcttcgcctAAGCGCTTCAGATGTTGAATCTTTGGCTGCGCTTAAGAGCCGATCTCCTGTCTCTGCTGGGCTCAGTCGACTTGTGAA
GGTCTTCTATCCGTATCTGGTGAATCAGCCTCGAGAAGAACTCAGTGAAAATTGGCATCCAGTGAGTAGCCTCCTGCTAGCGATGGGACTGCCTGTAGAT
CACCTGTACGTCTTCCTGGACCCAGTGTGCAAGACGCTTCTCCTGGCTGTGGAGTTGACCAGACGATCGAATAAGGACTCacaggatgaagaagatttcG
CGGTCTTTCCCAAAGTTACAGTCGTCTGTGACCGAGACGATGTGCTTCAATCGAGCGTCGACTACGTTTGGCGCACTCATCTCTCTGATGAAGCGAACCT
ATCGAACTTTTCTCTGTTCCCCTTCTTCAAAAGCTCATTCGGTGAAAAGGTTGTGGATGGAGTAAACGTCGAAGAGGGAGAAGGGAAGGGGCCATTGAAG
GAATGGTTTACTCTTGTTGGTACTCAGCTCACGTCCAAGTGGAAGCAAATACCGGCATCCCGGCTTTTATTGGAGTCCTCGACCCAAATTACTGCAAGTG
GGAACGCGATCACAATTCCAGGGGGTTCAAATATTATTAAGTCAGGGTTCCAGCTCGAATGGGGCACAACTGAAGGGGAAAAGATCCGACGAGTTATCAA
CAAGAGCGTGGAAGACGACACTTTCCTACTGGACCGCACTGTGTCGCCCCATTCCTTCTCAACGTCTCAATTGTCTATATGGCAGCCTACCAGCGCAATT
TTCGAGTATGTCCAAGGATCGGAGAGCTACTGGCTTAACGAAAACACCCGCGAATCACCGGAGACCCGTAACGTGCTTGTGTTTGTAGGCTGGTTCCTGG
CTAGTGCTGTAACACACTTCAGCTCGATCCAAGTGAGGATAcacgcgctgctcttctgcttATTACTGAACCCTCAACACTGCGTGAAGCTAGAAGAGTT
ACAGTCGTTTGACCCTCAATTATTCCAGTCCTTGTCCGGAATGAAAGACATGAAGGCGTCGGATTTTGCAGAGTATTTGAAGTTCGAAGGGGCTGACGAG
AGTTTGAGCGTTGGGGAGTACGTAGACAAAGTGCTTCAAGAGAAGTTCGGTCCCGCGTCTGGGATCGGGTGGCAGCTCCAGGCTCTTCGACGCGGGTTTA
GCCGCGTCATTGCTCTTGACCAGCTTTCTCGCGTCGGAATTGCCGAGCGAGAGCTGGTAGAAAGCGTTTGCGGGAGTAGCGCTGGGCCTAGGGGTGACTT
tgttgtcgatgaagttTTCCGTGTCGCTGCCGACGCGGAATTCACGGCCTGTGGACCCTTAATGAATGCGTTCTGGAAGACAGTGAACAACTTTGAGCCG
CAACTGAAGCGCAAGTTTATCAAGTTCGTGACGGGTGTAGATACTCTACCACTGGCAGGAACTGAGGTACGTTCATGGGTTCTAGCGTTGAGCTGCGATT
GACTGACTTTGGTCGTATTGTTTAACCTTCAGTTCCTACGAATTGAGATGCCGTTCACCGAGATTTCTTCGGCCGACCACGAAAAGTGCCTGCAGATGCT
CCCACAAGCTCATGTACGTGGTTTTAGTGGATTTCCCCAGCTGGTGGTTGACTCACGGACACCTTTCTCCTTTTTTTCCCAGACGTGTGATAACACGCTA
GAACTGCCGCATTACTGGAAGGCGCTTTGCTGGAGAGAGCAGCACGATGAACACGAAGCGAATCTGAAATtagaagaagagctggcgcTTTTGCTGGGGA
AGAAACTGCAAGATGCAGTGGAGTACTCGAGTGGATACGGACTGGATGGCACGTCGGAAGTTGTAGGAGTGATTGGTGACAAGGCGAAAACTGATGAGGA
TGCGATGGCAAAGGTGGGGGAGAGTTACGACTCGTTGGGGCTCCCCGCCTTGTCAGAAGGACAGAGTGCTGTTGATCTGCCCACGGAGCAGACGTCTGA