Description :
From Genome Similarity Track
Location :
Scaffold_563:263- 3092
Sequence
2829 bases(100 bases per row)
GGCATGTCGTCCTTGTATTCAGTCAGTGGGTACAACAGCCGAAACGTAAAGTCGCACGGCTTTTATCCATGTCTGTGAGGGCAGCCAGTGGGTGGGGGTC
GCCGACCTCTAGAAGCTAATGCTTCCGTTTCAGCTGCTGTGAACGCGACGTTCATACAACCAACCGGTGCTAGTTCTTTTATGTATACGTTACTAACTAA
TGCGCGACAGTTTTACGTCAGCTCGACATCCGTTAGTCGTCAACCCAGCCGTTCGAGACTCTATACCCACATTTCTTGGACCGATATCAGATGCCAAGAT
CACTTGAATGACATTACAAATTCAAAAGCTGCTAGAGAAATTCGAGCTTCACGCAAATGGAAGCGATGATCGATCATCTTGTTCGTTTTTATAGCACGCG
TCTCAACCAAAAGCATCATACCACTGCTAAAGCCAGGCGAGGTGAATGACCTGCCACTACCAGCCCACACCACGTTCGACTAGATCGATAGCTTATCGAA
CTTTCCTTTGCAGCTGTAGAAGTGTGATGCTTGCAGTAATGTCAACGCATCGTCCGTTACCCATACCCATACCGCGTGGTGGCCCAGAATGGTGGAAAAA
TTCATCGCATACTCGATACAGGGACAGTTGGCGAAGAAACCACGCACATGGGTTTGAGGCTGCAGCGTTTCCCCACATGTGGGGTTTCACCAAACTATAT
AACTGCAGCATTTTCCACACGTGTCGTTTCACCAAACTGGTTATGACCTGATACGCGACAAGTCAACCATCAGTAGATGCGACGCGCTATGCACATCGCA
CGATAAAAGTACTTCGTGCTCTCTAGCTGCGACTATGCTAGACACGCGCATTCCGCGGCGTCGTATGTCGTTGCAGCCAACCTCGTTTTACAGAACGAAT
TATGCATTTATTAGTTATCACAAGAATTATGCGGGGAATACTTTATTGTCAGCAGATAGAAATTAAATTTCTCGTGATGTATTTTTATTTCTCACACATA
AACTTTGGCAATCCGATAGAAATAAATACAGTGTGTGGATCGTTCGGTTTAAGACTCGCTCCGGATTCTGATACGGAATCAGCGCCACTCGTATAGAGTC
CCACACTTGACTATTCCATACGCCGGCTGGACAAATAAGCAAGCTAGCTGCTGATGACGCCCGGCTGGACAAAATAAGCAAAGCTAGCTNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNN