Description :
From Genome Similarity Track
Location :
Scaffold_1409:263- 2923
Transcript NameFunction/comments
Hyaar_Emoy2814704structural maintenance of chromosomes protein 5 puta

Sequence
2660 bases(100 bases per row)
GTGGATCTCGTCGTCTCGAATTTCGCCACACNNNNNNNNNNGCGTTCGTACAGTTCCCGTACACGCCTATCGCCACGGAAGCATTCCAGAGCTGCTTTAT
TATTCTCAATCTTGCCTCTCAGCTCATCCAGGTCATCTGGAAGCTCGTTGAACCGTTCTTCGTAAGATTCCCATGACGCCTCGTCCTCTGCTCTATGCTT
CAACTGCATGGCTTTTGTGGCTATATCCNNNNNNNNNNTCTTTCGTAAGCTTGTAAGCGTTTCGAAGGTCCCTGTTCAAGCGGAAAGTGTAAGCGCTAAT
ACAGCTCCGCAAAAGTTCCATTACAAAGCTTACCGTAGGGCAACTTCCATTTGCTTCAAGTACTTTTCTGTGAAATCTACTCGGACTTGCTGTGTACCGA
GCTGCAGTGATAGGTATGCCTCACGAGCAGCGGCTTTGTGCAGATCTTTTAAAAAATGCAGCCAACGCTTTATCTGCTGCGCTTGCCTGTAATGATGCAT
TTTTGTAACGGAGTATTAGTACAGTTCGATGACTTGTCACATTCATCAACACTTCGCTCCACGTACTTCAAAGTCTGATTTCTTAACTTTCGAGTCAAGA
CTTCCTCCCTCTTCGACACGTCCTGCCCAGCAAGAATGTAAACATTTCGTGCGTGCAACCAAAGCAAAACACCACACCCACCTGTGCAACCTCACTTTTC
AGCGAGTATATCTTGTTACCATTCTCGGCAATCTTATCATCTAAGCGAATAATCGCCATCCGCTGGGAGCGGATTTCTGCGATGCGATGCTGGACTTTTC
TTTTTTCATCCGCATACGTCTTCTCTTGCTCTTTTAGGTCAGCCGTCTGCAATGCTCATGCGAAAGTAGTACGCACAATCAGAAGGTTAGCCGTCTGCGA
CGCTCATGCAAAAATAGTACGCGTGATCGCCTACCTCTTCTCGAATACTCCTCTCCCTAGAACCCAAATCATCCAAGACCTCTTTTATTTCAATCTTCTC
GTCTTCCACTGATGTGGAAGCCGCCAACAGACGAGGGTTCAGAAGATCGTTTGTACGCGTAGTCACGTTCCGGTTTCCATACTTAGAAACTGTATAAAGA
AGCGCTGTTAGCCACGTCTTCCACGGACGACATCACATACAATCACTGATTTGCAGCAAAAACCTGAGGTAACGTATTTCTTGTACGGAGTCACAAATGC
TGCTTTTCTCTCAGCTGACGCGATCTCAGAGAAAATGTGACCACCTTTGTTGATAAAGTCTTCCGTGAGCTGAGAGCCAACCATGACGGTGTGTAGACCA
CCATGAGCACGAAGAGCTTCGTGTACAATATCCGGAGCAGATACCAGCTTATCACAGCAATCGAAACGTAAATCACCAAACATTTATTTTCAGACATGCA
TTGTCGCGTACCTCATCCAAGAAACCCGTCATGCCATATCTTTCGCGATAGTCTTTCATCTTATCGCTCGAGTACGGCCGATTGAAAGCATGGCACTTTC
CGGCTTCGACGTTCAAAATCGACGCTTTTATGTGACGATCAGAGTTTCCGCTTTTTAACTCGTGGAGAATCGTGTTATAGTCGTCATAGCACTCCGTCAC
TAACGCGCCCAAAAGCCACTTTGGCAGAGTGTCTTCAACGTACTTCGCATGAATCGTCTCGTTGAGCTTCATCTGTCGTAGAAAAAGGGTAGCATCGGCA
ATCACGCTAGTCGTTAGAATCACATAGTATGGAACGGCCATGTAGAGTAAGTTGACCACTTACCTCAAGCGCAACTGGCCCCCATACTTTGCGCTTCAGC
CGATATTGATTGTTTTTGACCCAATCCGCTGCGCGGATACAGTCAGGATCGATCCTCTGAAGAGCTAATCGACGCTGCACGTCCTCGTTTTCAAGCGTTT
CGAGCTTGCTTCTCATCTTCTTCTGCTCATTGTCGATGTAGGACAACTCGCGAGCAAGAGATTCTCTTTTACTGCGAATTTCTGTCTCCTACGCATCAAA
GCGACAAGTCTAGCAGTCAGATTACAAGTGACTGACAGAACCTCTTCATGAATCATCGGTATTGCGTACCTCCAAATTTTTAGCGCGTTGTTCCTTCTCT
AACTTCTCTTTTTGCTCTTTAAGATCCGCGTCATCAGCCATGCCCTCGCGCTCCTTTTTCCACTGCAGATGAGCGAACAAGTTCAGATTTAACGCACAGA
TTGGGTCCGATGCAATAAATACGAACCTCCACCATATCCTGTTCCAATCGCTCAAGTTTTCGACGAGCAGAGACGTGCCGGGAGCGTAGCTCTGTGACAT
CGATCGAGGTCTGATCTTGAGCACTTTCCATAGAGTCGATCTGCAAGTCCACGGTTATTTGCTGTTCGATGCGACGATACAAAACAAATGTGAGGATGGA
TTTATCGTACATGACTCTTTCCCTGTCGTATTTTTTCGACGAGCTGTCGCTTCTTGTCGTCCATGTCTGATAGCCTAATTGTTTGCAGCAGGACCGACCG
TTAGCTTCGAACCAGCAAAACACCTCCGAGAAGGCAGTTGAGACGCACTCTGTTTTAATGTCCTCTAGTTTGATTGATTCTTTCTTGAGAAGATCCACTA
GAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN