Description :
From Genome Similarity Track
Location :
Scaffold_4326:263- 1278
Sequence
1015 bases(100 bases per row)
CGGAAGATGAGCAAGTCTGCTACCGTGAAGGCGGGGATCTACACGCCGAGGATCTGGGAGAAGGCATGGCGGTGATCCCGGAGGTACCACTGACCACAGA
AGAGGTCACGATTGATGATATCCAAGTAGATCCAGAGGCGAATGAACCTGCTGAAGTGGATCGTCTGCGTCAGAAAATCTGGGAGAGCCGACATCTGCTG
ATTGGTAAAGGTAATGCGTTACCGCCCGCTGCCCGCGGAGTCAAATGTGGCATCGATGTCGGCGACGCGAAACCGATCGCTCAGAGGGTGCGGAAGGTGG
CGCCTCAGTTCCGGGAAAAACTATCGGATCTGATTAAGGGCCTGCTGCAAGCCAAGATCATCAGTTTCTCAACGTCCCCGTGGGCATCCCCAGTGGTAAT
TATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCATTGATTACCGGCTAGTTAACGGTCTGACTCGATTGATGGTGTATCCGATGCCTCTAATCAAT
GAGCTGTTGGAAGATTTAAATAAAGTACTCTGGTACTGCTCTCTTGACATGGCCAGCGGTTTTTGGGTAGTTACTATGACGGATCGAGCTCGCGCGATAT
CCGCATTCGTCACACCGTTTGGACTGTTCGAGTGGAACCGGATGCCGTTTGGATTGAAGAACGCACCCCAGATCTACCAACGTCTAATCGATAACGCTCT
CTATGGATTCACCCGAATACCGGAACCCAAAAGGGGTGGATCCGGGGAAGATCATACGGAAGTAGATCCATTTGAGGCAGGAGAGCCAGGGGATCCTGGA
ACCCCGTCCGTGTTAGGGCGCAGATCTTACATCGACGACATTCTAATCCCGGCAAAATCGTGGGATCAGTTGTGCGAAAGAGTGACATCCCTACTGGAGG
CGTGTACTAAGTGGAATCTCTCTATCAGTGTGGTAAAGCGCTATTGGGGGATGCGCAAGGTGGATTACTTAGGCCATCGAGTTTCCAAGGAGAGATTGGA
GGCGAATCCTAAGGA