Description :
From Genome Similarity Track
Location :
Scaffold_89:262978- 265398
Transcript NameFunction/comments
Hyaar_Emoy2808853hypothetical protein
Hyaar_Emoy2808852hypothetical protein
Hyaar_Emoy2808854Rab1B, RAB family GTPase
Hyaar_Emoy2808855YPT1_NEUCR GTP-binding protein ypt1

Sequence
2420 bases(100 bases per row)
TTGTCAGAACAATGTTTGCTGTCAACGGACCAAGCGGGCCCACCTCCCGTAACGAGCGGCGCGCAAAGAGCGGCCGAGAACGAGAGGAAGAGGAGACCAT
CAGGAAGTGTGACGCCGAGAAAAAGCGCGAGGAGTTTTTTCAGGAAAAGCGCGCGCTACCCGACAAACGCAGTCAAGGTGCACGAAGTTACACTCGACAA
CGTTAGAGCCACGTTTCACATACGCCGCTCATGTTGGTACAGGCCCGGAAAATCCAGTGAAGACGGCGTGCATATCCGATATTTTCAAGGTGTGCGGTAG
CTAATTGAGCCTATGCAATGCTTCGGTATAACGAGAGTGACTTGTTGTCTGTCTACAGGGCTGTCGGATCGTGTTTAATGGCCGCACAGGCAAAATGTCT
TCGTACGATACGGAGACGATAGACGTTCGTGTACGAAATCGTTCACACTCGTATCTCTTGTCTATTATTGCATAGGTACAACTTGGCAAAGTTGGTGCAG
GATCATGGTGGCAACGTCGCGTACGTGCGGACTTTTGTTCAACTTCCCACTCACATGTCACTAGCTGACGCTCGATCCGTAGGTTTGCATTGACGGCAAC
GCGCGTCACTCACATGGTCGGTGCCAATCTGAACGGGTCCAAGGCGGACAAAGTGCCTAAGGTATGCTTATGTTTTTACTCGAATGACAGCATGTTGCTG
ATCGCCTGGACACTTCTTTGATGACACAGAACGCGAGCAGGCTCAAATTCGTGACGCCAGGTATTCTCCTACGTTGTCGGTGACTGATCGGTTATCGTTC
TCATCTCATTGACGATTTCGGCTGACACAGAGTGGATCTTGCAGTCTGTCAAGCTCAAGAAACGCCAACCTGAGTTTGATTTCCTCGTCTACAAGGACAC
CCACACGCTCTGTACCGTGTTTTCGCGAGCTGCTTCATCACCCAAGCGAACAATTTCACGGCATCCTACCACTGCAAGTGGTTGATTGCCTGCAGACGGG
TAACATTCATCCGAAACGAGCTTCCCTTTCACACACGAGAAGCTCCGATAGCCACAACAACGAAACGCAATCAATTCGCACTTGTAAACGAGAAAAAATA
AACCATGTATGGGGTCAAAACTAACCAGGGTAACACATGTTCACTCCTTTCAGCCAATACCGCTAAGCATGCATGACCGACATGAGGACAAGAGCGCACA
TCCGATCTGATACTCCATTCCAGACGCCATCAAATCCTCAAATAGCCTCCACACCCGCGTCGCACCAGCGTTTACTCTTATCTTGTGCAGAACCTCGTCG
TTGCGCAAGATGATTCCAGCGCTATAAAGCTGCGGCCGGGTCAACTATTGTACGCACCAGGCGAGGGGGCAAGACAACACCGCTTAACAGCACTTCGACC
CTCCGTTGGAAGGCACCTGCTGGCCGGGTGTCAGCTTGACGCCAGCCTTGGGAGCCACGGGAGCGTTAGCCATGCGCTTCTTGATCTGGGCAGCCATCAT
CATGAAGGCTTTTTCGACGTTGGCTGCGTTCTTTGCACTAGTCTCGAGAAACTCAATCCCCAGACTCTCGGCAAACTCCTTGGCGGTATCCGTGCTCACC
ACCCGCTTGGCCGTCAAATCACTCTTGTTGCCCACCAGCAACTTGTTCACGTTCTCGCAAGCATATCTGCATTACACAATCAAAACTCATGAGTCCATGA
CCGTCCGCAACCAACTCGACAACTAAACCCTCGAGCTCTATCAACGCACCGGTCAATCTCGTGTAGCCACTGCTTAACATTGTTGAACGACTCTTGGTCA
GTCACATCGTAGACCACAATAATGCCGTGGGCACCGCGGTAGTAACTGCTAGTAATCGTGCGGAACCGCTCTTGTCCCGCTGTGTCCCACTGTGCATGAA
AAACCATCTACCGTCAGCTCTGCCCTTGTGAAACTGACTACAAACAACAGCTGGCATACAATCTGAAGCTTTATGGTCTTGCCGTCCAGCTCAATGGTGC
GGATTTTCTGCACACGACCACAACAAACACCTCGTCAGACAATACATCCTCCTTCAGGTCGCAAAAGCGCCCAGTTTGCCAGCCAAACCAGGCAGCGCTC
CAAATCCTTCGTTACTCACAAAGTCTACACCGATCGTCGAAATGTAGCTCTCAGTGTACGTGTCGTCAGCAAAGCGGAGCAGCAGACACGACTTGCCGAC
GCCCGAGTCACCAATCAGCAGCAGCTTGAACAGGTAGTCACTGCGTGCCATAGATAAACACCCAATCATTAGATCCTGTAGCTCCATTCATTGACACACT
CGGTCCTGTACGCACTATTCCGGGTTCATCTTGAGCGATTATGAGGAGAAGGAGAAGCGGCGCGTGAAGATGCAGAAGCTGTGACAGAACAGAGAATCAT
CAATCGTCATTACTGCCACT