Description :
From Genome Similarity Track
Location :
Scaffold_20:262961- 264230
Sequence
1269 bases(100 bases per row)
CGACCGAGGAACCGTACGGGGTGTAACTTGCCTTCATGTTCTTGTATGAGTGTTGTACTCAACGCCAATTCATTAGCAAAAAGCATCACATGAACGTCCT
TTGCTCGGTCGAAGTGCTTCAAGATTGGAGCCTCGCCCACCTTCGCTTGTAGTGTCGTAAATGCTCGGCGAGCTACCGAAAGATCGCCATTCGGCCAAAA
GTCTTCCTACTTCAGCTGGTACAATGCTGTACCATATACCGCGAAGTCTTGGATGAATCGGCTATAGTAGTTCAGTGCCCCAAGGAATGATTGCATCCCT
CTCTTGGTCGTTGGGAGCGACAGCTCGGTGATGGCTGCAAGCTTTTTCGGGTCGGCTCTTATTCCTTCTAAGGAGATCACATGAGACAGGAAGTCTACCT
TGTTTGGCAGAAGATGCGGTTGGTGAAGCTGACACTTATCCGGCATTCGGCAAATCGACCTAGTAGTCGGCCTAGTGTCGCTAAACAGCCATCAAAATCC
TCGCCACCGAAGCAGATGTCGTCAATAAAAAAACAACCGGCGACCAAATACTGGCACCAACGTTGACTCATCAGGTTCTCCATTCTGAAACTTGGCAGCG
ATAGGATCGGTGACCAGTTGTATTAATGGGTCAGTGTCTACCGAAGCTTCCCGATCTGCCTCGAACTTAGTTTGAAACGAACCATTGGTGCTGGTCGCTT
GACGCTCTTTGGCCTTTCTTTTAGCTGCACTCATCAGCTCCGAGTATTTACGCCATCCCCCCTTTAGGCTGAGCGAACTCCCATAACGCATTGTCGATTA
TTCGTGGTATATTATAGGGGCGTTCTTCAGGCTGAAGGGCATCCGCGCCATTCAAACGGTCCTAGTGCACAAATGAATGCAGACACTTTTCGCGCTCGTA
GGGTCATCATGATGGTCCAGAAGCCGCTGGTGGCATCCAACGAGCAGAACCATAGGTAGCTCTCGAGATCTGTCAACAGGTCGTCCACTAAAGCATCACA
TATACCATGATTGCGGTGATGGCATTTACCATCGTGTAATCGATGCTGAGTCGTATATCCAGACCGTTCTTTTTCACCACAATCACGATCGACGACGTCC
ATGGGCTGTCCGAGGAAACAATGAGCCCAGCTCTAAGCAAGGTTCTTAACAATTCGTACAGCTTGCCGAGGTAGCGGAGTGGTACACGTCGAGCACGCTG
TTTAATTGGGGCATGCCCTTGTGTGTCGATGTCGCACATCACACCGTACGCTGGCGGCGGTAACGCGTT