Description :
From Genome Similarity Track
Location :
contig_36:262959- 264063
Transcript NameFunction/comments
g7466.t1hypothetical protein

Sequence
1104 bases(100 bases per row)
ACCCGCAGCAAGATCCACGGCGAAGAACAAGACGACGGAAGAGTGACCATGAGCCTCTCGAACAGCAACAGCACCAGCTCCCTGCCCCCGTGGACGAGCA
CAACGCGTGCGAGTACCTCGACACGGCGCTCACGATCTTCGTGATCGGCGCGTCGGGCGACCTGGCCAAGAAGAAGACGTACCCATCGCTCTTCGCGCTC
TACGTGTCGGGCTACCTGCCGGAGCACGTGGTCATCGTGGGCTACGCGCGCAGCCACAAGGAAGAGGACGCATTCCGCGCGCAGCTGGCGCCCTGGATCA
AGCCCAAGACGCCAGCGCAGGAGGCCCGGAAGGAGGCGTTCCTGAGCAAGTGCATCTACCGCAGCGGCAACTACGACTCGGCTGAGGACGTGGGCAAGGT
AAGCAAGGAGATGGATGCCCTCGAGGAGGCCCAGGGCGCGGCCGTGGCCAACCGCCTCTTCTACTTCGCCATCCCACCCACGGTCTTCGTGCCCATCGGC
ACGAGCATCAAGAAGGCGGCGCTCACGTCGCGCGGGTGGAACCGCCTCATCGTCGAGAAGCCCTTCGGCCACGACCTCGCCTCGTTCAACAAGCTGTCAC
AAGACATGGGCGCGCTCTACACCGAGGACGAGATCTACCGCATCGACCACTACCTTGGCAAGGAGATGGTGCAGAACCTGCTCGTGCTGCGCTTCGGCAA
CGCCATCTTCGAGCCCATCTGGAACCGCAACTACGTCTCAAGCGTGACCATCACCTTCAAAGAGGACATCGGCACACAGGGCCGCGGCGGATACTTCGAC
TCGTACGGCATCATCCGCGACGTGATGCAGAACCACCTGCTGCAGGTGCTTTCGCTCGTGGCCATGGAGCCGCCTGTGCAGGCTGCCGGCAAGGACTACT
CGAACTACATCCGTGACGAGAAGGTCAAGGTGCTGAATTGCATCGAGCCCATCAAGCTCGAGAACACGGTGCTGGGCCAGTACCAGGGCGACAAGGAACG
CAACGAGCCGAGCTACCTTGAGGACCCGACCGTTCCCAAGGGGTCGACGACACCCACATTCGCGACGGCTATCATGTACGTGAACAACCCGCGCTGGGCT
GGTG