Description :
From Genome Similarity Track
Location :
Scaffold_20:262910- 264233
Sequence
1323 bases(100 bases per row)
AGTACCTCCTTCTCCACTGGATGGTAGTTCATCTCAGAGTCCTTGAACACCCGACCGAGGAACCGTACGGGGTGTAACTTGCCTTCATGTTCTTGTATGA
GTGTTGTACTCAACGCCAATTCATTAGCAAAAAGCATCACATGAACGTCCTTTGCTCGGTCGAAGTGCTTCAAGATTGGAGCCTCGCCCACCTTCGCTTG
TAGTGTCGTAAATGCTCGGCGAGCTACCGAAAGATCGCCATTCGGCCAAAAGTCTTCCTACTTCAGCTGGTACAATGCTGTACCATATACCGCGAAGTCT
TGGATGAATCGGCTATAGTAGTTCAGTGCCCCAAGGAATGATTGCATCCCTCTCTTGGTCGTTGGGAGCGACAGCTCGGTGATGGCTGCAAGCTTTTTCG
GGTCGGCTCTTATTCCTTCTAAGGAGATCACATGAGACAGGAAGTCTACCTTGTTTGGCAGAAGATGCGGTTGGTGAAGCTGACACTTATCCGGCATTCG
GCAAATCGACCTAGTAGTCGGCCTAGTGTCGCTAAACAGCCATCAAAATCCTCGCCACCGAAGCAGATGTCGTCAATAAAAAAACAACCGGCGACCAAAT
ACTGGCACCAACGTTGACTCATCAGGTTCTCCATTCTGAAACTTGGCAGCGATAGGATCGGTGACCAGTTGTATTAATGGGTCAGTGTCTACCGAAGCTT
CCCGATCTGCCTCGAACTTAGTTTGAAACGAACCATTGGTGCTGGTCGCTTGACGCTCTTTGGCCTTTCTTTTAGCTGCACTCATCAGCTCCGAGTATTT
ACGCCATCCCCCCTTTAGGCTGAGCGAACTCCCATAACGCATTGTCGATTATTCGTGGTATATTATAGGGGCGTTCTTCAGGCTGAAGGGCATCCGCGCC
ATTCAAACGGTCCTAGTGCACAAATGAATGCAGACACTTTTCGCGCTCGTAGGGTCATCATGATGGTCCAGAAGCCGCTGGTGGCATCCAACGAGCAGAA
CCATAGGTAGCTCTCGAGATCTGTCAACAGGTCGTCCACTAAAGCATCACATATACCATGATTGCGGTGATGGCATTTACCATCGTGTAATCGATGCTGA
GTCGTATATCCAGACCGTTCTTTTTCACCACAATCACGATCGACGACGTCCATGGGCTGTCCGAGGAAACAATGAGCCCAGCTCTAAGCAAGGTTCTTAA
CAATTCGTACAGCTTGCCGAGGTAGCGGAGTGGTACACGTCGAGCACGCTGTTTAATTGGGGCATGCCCTTGTGTGTCGATGTCGCACATCACACCGTAC
GCTGGCGGCGGTAACGCGTTGCC