Description :
From Genome Similarity Track
Location :
contig_25:26290- 27721
Transcript NameFunction/comments
g4885.t1phospholipase D-like protein

Sequence
1431 bases(100 bases per row)
TCATCTTGAGCAGCAACCTTAAACTGGTCCGCTGCATCGATGAATTTCATTGCGGCGAGTTCCTCGTAACTCAGCCGCGTCATCTCCACAAATTTGCGGA
CGCGCATGTCGCGAGCTAGCTTAAGCACAGTCACTCCATCTGGCGACTCAACTGTCTCGTCGTCAATAATGTTGGCGTTGAGTCCGAGTCGGACGTCATA
CTGCGACGATTCCAGTTTGCGGATCCCAATGAAACGTACACATCGTCGATGAGGACCAGTTTAGTGTGGACGTAGATGTCGAGATCCTTCTTAGTGGTGT
AGATTTGCACCTTGTTCGGGAACTTCTCCTTCATGGGCCCAATCATCTCGTATAGGTACTTTTCGTATCCTGAGGCCTTGAGAAGAGCGTCAGGTGGCTG
TACAAGTACGATGAGACGCTGGATTCTGGGCAGGACTTCCATGAGTGCATCGAGGAGCTCAGGCACGTAGATGAAGTACTGGTCTTCGATATAGATGAAG
TTCTTGGCATTTCGGAGCGCTTTGAGACGAGCTTTGAAGAGGGACTGTTCTCCACGTGGCGCGAATTCCTTATAGTGCTTATAGGTACAGCTGAAGGTGC
GCACAATTTGGATATTTTGGTTGCCGAGCTTTGACGATGTATTGCTGCTGGCGTAGTCGATCGGCGGCAGCTTCTCGTAGTCCGGATTGTCGAAGCTGAG
CAGGTCGTCCTCGAGTCCCTGACACGGTTTGTAGTCTGAGTTCCAGCGCTGGAGGAAATTGTTGGCCACTTCCTTCGATGCCGGCCCGTGGATCCTAAAG
TGCGCGTCCATCCATCCCTTGTTGCGAAACGGGATGTTGGCGGCTTCACGGATGGCCGTGTTATTGTGGTAAATGGTGTCCCATCGATCGTTGGTGAGGT
CAATGCCGCCAACGTAAGAGATGGGGTGGTCGTCTTTACCAGTCGACTTGTTTGCTGCGATGACAATCGTTTTTTGGTGGTGGGACGATGCAGCTAGCGG
AAGTCGGTCGTCGAAGAGGTAGACAGCCTTGGCTCCGTTAACTTTGGACGGTGGGATTTCGTTGATGGCGTCGCGCGCGTTGGTGTTCTGAGACGTGAGA
AGAAAATTTGGCCACGACAAGAGGTTGACACTTCCACCACGCTCGACGATGCCTTTGAACATTACGTCAAAGCCTGTCTTGGCGCCTGTAGGGTCGACGT
CAGCCTCAAATGGAATGACACAAGTATCCCAGCCTGTATACATGACGCGGTCGCCCTCCTTCGTGGCCGAGAAATCGTCTACCACTGCACTGAAGAATTC
GTTTGCCGCAGTGTAAACCGTAACATTGTTGCCGGTCGTGTACGTCTGCAATCCATCACGTGGGACACCCGCGCGAGTCGACAATGTCTTCTCCGTGAAT
GAACCAGTCGGTGGCTTTGAGGAGAGGTTGG