Description :
From Genome Similarity Track
Location :
Scaffold_334:26290- 36813
Transcript NameFunction/comments
Phypl_g7101hypothetical protein PHYSODRAFT_262124
Phypl_g7102conserved hypothetical protein
Phypl_g7103hypothetical protein PHYSODRAFT_509593
Phypl_g7104hypothetical protein PHYSODRAFT_286379
Phypl_g7105conserved hypothetical protein
Phypl_g7106conserved hypothetical protein

Sequence
10523 bases(100 bases per row)
GGAAGATAAAGGCGCATAAATGATATTATTCTCGTTGCATTCGGCTCTTCCCGCCGTGCAGGACGTCTCTTGAGGTATTACGGATTGCTGCGGTGACGCA
ATAAATTAGGCAAGAAGCAGGGCGACCGACTCCTGCACGTCTTGTCGGTAGGAGTCGTCGGCCAGTACCTGCTCGAAGGACAATCCGGGTGTGTACGGCA
GCGGCTCcaagccgagcagcagcgggtccaTGTCGACGTCCATGTCGAGGGCGGCGAGAtcggcgaagctggagctgctgctcccggCATCGCTTGCCAC
GGGGCTGCAACCACCCGTCAGTAGCTGTCCGAAGCCGCCGCTCAGTGGGGACATGGCGCCGATGGGAAAGgccgacggcgagcgcggcgagccCTGCACT
GTAAAGTTCTTCACGCGCTGGATGCAGCCCGTGGCGTGGGCGTCCACGCGGTGCTCGGGGCGCACAAATTTCTTCTTCTGTTTGCGCAGGCCGCGTCGCC
GGCGGTTAATCTTCTGTTGGTACTTCTGCGCGTGCGTCTGCACCTGCTTGATGGAGCGCGTGccgatgaaggcggcgatggagcGCCACGGGCCCGTCGG
GAACATCTTCATGGCGTGCAGGAACTGCTCGTGCTCCTGCTCGGACCAGAGGCCGCGTGTGATCGGCGTCGTAGGCGCcggcgcgacggcgaggctGCCT
CCGTGGGTGCTCGTGGGCATCATGATCATGGTGGCAGTTGCTGCTATGGTTGCTGTGGTGGGCTGCGACGGAGTGCGCGGCTCGAGCAGAATTCGGAAAT
GGAGATTGATGTGATTAGGCGCCTCCGCTGGTCACTTTTTCAAGCCTTGACACGGCAGGCCCTTCTGTGCGAAAAAGGGGGGATGggcagcgccgagcgc
gagTAGGGGTATTTTATGGCTCAGCGTTGATACCTACGAGAATACCGGTATTGAGAGCTTCCGCCTGTTGGCTGTGTAAAATTCTACGAAGAGAATACCG
ACCTGCGACTGACCAATGGCAGCTGGGCATCACGCCGGCTCGTCTGGTCAGTTCCGGTACAGTACCTCAAATGGCGAGCGCTAAAATTATCGGTCGGTAA
TTTACGAGTGCAGCCACCGGCTGCTGGTCAACACTGGCATGTGAGAAACCCGAGCGCGACTTGAATGCTGAAAACAGCTTTTGCTCCAACCTGCGGCGCG
CAGTAGTCGCGGCGCCAGGCGAAATGCAAAAACATGCTGGCCGGCTGCGGCTCGCTGTAGGCTGGCTATCCAGGCACGGAGGTCAGAAAGATGCTGCTTG
GCGTGTCAATTTTTGCTGTTTCATCTCAgcactgccgctgctgccggttGCAGCTCCAAAACGCGCAGCGGGCAAAACGACTTCGGAGCCTCGTCAACGC
GAAATGCATTTCGGCGCGGTCTCCGCTAAAAGCAGTAACCGAAGTTTGCACAAGATGCACCATCGCATCGCCCGGGCGCGGCGCAAATAGCATGTAAAGG
CCCCGGCCTGCATACTTTCGCGTCGGAGTTCTCCGTGCGCGTCTGTTTGCTCTGAGATCACTCGCGGTCGCACAAGTGGAAATCAATGCAGGGCCCTGGG
GGTTCCTCGCCGTATGGAGGACCCAGGTCTCTTCGTCACGCAGCGCAGATGTCGGAAAGCTTGGCTCGGACGGATTGCTTCCGGTTGGAACGACCGAGCT
AATCGCACCAGCAGTTCGAGCGGCCCGATGTCTTATCGCATATGCCGCCTCCCTGTCTGAGCCATGCGCTGCCCTATACAGTTCGTTGCGACCGAgttgc
ggcgctggcggcgatAGCCTGGAAATGCAAGTACCCGCCGCCTGCCGGTCCGCGACCATAGCCTGGCTAATCCCTCGCAGACCAACTGGGCCAGCCCCAG
TTGAAAAGGAAACCAGGTGCCCCTTTGTAAGCGGTAGCGTCACCGCTTCAAATGTGTAAATCCCGGCACATTTTGGTATGGAGATAAATTACTTCGGCAG
CCTCCGTGCGGGCATCTGTGTGTCGCATATATGCTGTAGCGGAGTCAGTCGCGGTGCCGCTCTCCAGAAAAAGATCGGCCTCCGCGCTGAAGGTCGCagg
cgttgaagttgccttgcacagcgagcgctgcgaTTTCTGTTTTTAACAGCGCTAGACCAACGGCACCGCTGCGATTCACGCTCCTCGGTCTGCGAACGTG
ACGCTCGCCGCCGCACGCTTCCTTCGGCCTGGTTCCTTTCGCAGCCGCGTCCCTCCCTTCGCTTGCGAGCGGGCTCGCGTGTTTTGTCCAGCAGAGTTGC
ATGGACTGCATCAAACGGGCATTGCTGACTCCGCGCAAAAGCGCTCGACGAGTAGGTTGTGTATGAGACACCGCTTCCACAGGCGCGCTGCATGCGAGTC
GCGGCGCTTTTGGGAAGCCCCGAGCTGCGACGCACTCCTTCGCGGCGGAAATGCTCTCGGCAGCGCGTAGCTGTACATTTTTGAGTGGATTCCAGTACGC
CTGCGTGGATGGGTTTGGCTGCGTGCACGACTCCCGCGATGCAACTCtcggcggcaacgacggcATATTGCTGCAAAATCGACAAGCTAGGCCTCGGGCG
GTAGCGAGCTTGGGCTGGCTAACTCGGCGCAGGCACGTCAACTTGCGGCGGTGCTTACTCCGAGTTACAGCGCGCGAGGCTAGCGCCGAGCCCAGACTCA
CCGTCGGGACTCTGCCGGACTTGTCTCCAAACGAACATTCGACTGCGTTCGTCGGCAGTCTGCTGAGTCGCGGCACTTGATGTGTGTTTTGGGGAAATAA
TTACAGTACCAGTGTCTTCCTTCCGCCGCCCATCCCCCTGCGGGAGGACCAAAATCTTTTTTTGTGGACCCACACAAATTTCGCACGGATATCCCGCAAG
CCAACGTCTGCATAGCGGCACCAGTGCCGCTGGGCCTCGTGTGGCGGACGCCGCGGCGCGGATTATGGCTGCGTGCGACAAGATTCAAGATCGCCGGCGC
GCTGCGAGTGCGGAGACCGAGAGCTGCTAGACGCGCTCCCACGTAGAGGCGTTGCACGCCGCGCGCAAGGTGCAGATCGCGAGGTAGCCGCGCGGACGTT
GAGGAGTTTGTTGCGCTGCAGTCTTCAGTGGCAATGGATTCCCGCGGCAAAGGATACCTTCAGCAACGAGCGATGAGGAGCTAGGGCGCCTCCGAGCGAC
GTGGCTTGCATGGTGATCTGCGAGGCTGGTGGCGTGCATATCTTCTGTTCAATGTGGCAGAAGATCGCTGTCTGAGCCGCAGACTCTGAGgccgctggcc
aagttcgGGGAACTTTGGCGTTGATCGGATCGAACTGGAAGTGTGCAGGTCGGCCGCTACCGCGGGGCTGTCCATCTGAGTCGTCTGCCAGCTTCGAACC
AGCGTGGCAAAGCTCTGAGCGTGGAACTAGATCACGGGCGCGATTTGTCCCGCCGCCCCGCGGTGCCGACTTCCTGTGTCTCAAAGTGGTTTGCTATCAG
CGCTCTCAACTCTCTCCGCTTGTCGGATGCTCAGACCGTTGGTATGCGACGCAAAATGTCATGCTGGCTAAAGCTAGCATAACTGAAGTTCTCCTGCATC
AGCCAAAAGCGCTTCTCATTCCTCAAGTGGCCTCCATGAGACCAGACCGATCTCGCCGTCCACCGAGTGTTCCGCCACTCCTTGGGGCTGTAGCCGAAGA
CTCCAGGCAACGGTGATGTGGTGCCCCTGGGCCCAAAACGGATGAAGTAGTCTAGTCTAACTGAGGTGGATGCCGAGTCTAGTATAAAATGGCATTAAAT
CATTTAGTCAGAGACAGCAGACCAGGAAGATCTGCTTCGCCTCCCAGCACAACCACAGCTTGTCCATGTCGTTCATGCCGCAGCCGACTTCCGCCGCTGC
TTGAACGGCGGCTCGTTTTCTTCCTCGGCCATAACGTCCTCTTCCGTCGGGACGACCTCCTCCGACTCCTTCTGCGTCACTGCcacgctcttcctcttca
aaCTCTTACGGGCctctgccgccgctgcgcgcTTGTCAATCTGAAACTCGAAGCCCACGGGCGTCGTGAGCTTCGGACGTCGAACCGCCGGGACGCCGAC
GCCTCCACTGGCCGAAAGAGCTTTGGAAAACTGGTCACTCTTGCCGGGCGCCGCCCCGTGCGTCGTAGAGTTGTGGTACTTCtgcgtcttgcgcttctgg
ACCTGTACTCGCTTGCGGATGGCCgcgatctccagcagctcgcgggACGTCCGCGTCAACATGTCGGCGCGGGAGCGGggcgtggccttcttgagcttgt
ggAACTTGGGCGACTGCGGGATCGTCAGGCGAccgttctccttggccacgcgcgccaGTCGACGGCGCTtgtgcgccagctcgcgcgcctctgccagctc
cttgtccttTCCGGTCAGCACCTTCTTCCGGAacgcggccagcgacgccttcGTGGGTTTCAAGAGACGGTCAGAGGACGAGATCGCGCGCACTCGGGGC
ACGCGCGAGGGTATGCCGCGGTACAGGGCGTCGGGGTCTTTGTCGTACACGGGGCGCGTCGTGGGCGCCATTATACCGAAGCGAGATGCACGCAGCAATT
CTTGAACTGGAGTTTGGCGCGGGAGAACGCGGcatacaaacaccaagtcATTTGATTTTCAAAATTCAAAAGCATTATCGACCAATCAAAATGGCAATTT
TGCTACCAATGAGGATGGAAACCTATTTTCGttccaagttgaagcgcttcaacatCGTGGTGCTCTCTCTGTAGTCAAATGACCACGCGCCCAGTGCCTC
CAACTCGATCTCGACGTGCTGTCCCTCCGCCGAATGCCGAGGCACCAGCTGCagtgcaggcgctgcacgtgACCATCCCGCTCAAACCGCAGCAAACGCC
GACTGCGCTGCCTCTTCGATTGACACAAGCAGTCAAGGACGAGTTCGCCATCCGCTACCTGCATCAGATTGGCACCAACTCCACGCCAGAGAACATCGCa
atggtgctgcagcatttACCACTCGAAAAATGTGTCGTCTCGGCCGCCTGGAAGTCGCGCGGGTCATTggccgacgtgctggcgaTCGACTTGAACCCGA
AGTCGCTTACTCAAGCGGGTGAACCTCCAGTTAAAGGAGTTGGTGCCACGGCGAAGACCGAGACAGATACAACTTCAATAGCAGCCCTGTTGTCGCCGAG
GAGACGACTTCGGAGCCAGCAGACCCGTCACGCTTTTCAAATTGGCTCGGTGTGCTTCACCTTCGACGACATGAAACGCAAGTTCTTGCTGCCCTTTAAG
CTGGCCACGCCACCACCGGAACCTGACGTGTTACAGCTTTATGGAACTCATTTAGAGACCGGCACGGACTTGGCAGACACGAAGTCGCCCAACCAAGTGG
AGCAGTTTAGCGCTGTGCCTGGCTCACAGATAGCTCTAGGCACTATCGCCAAAtgggagacgctgcggcgCCACAAATCTGTAGACGAGCGCTGCGTACC
ACCGAGCGCCGGCACAGAGACGGTGTTTGAAATGCACAACGAGTTCTACCTCGCGTTGCCGTTGACCTCGTTAGGCCTGCCCGGGGGTGATGAAGACACA
CGGACAGTGCTGTACGAGGCGCTGCTAAGCCCCGCAATGGTAGAACTTGTCCAGAGCACGATGCAGTACCTCTTCCTCACGGTGATCCACCCTCAGACAA
CAGCTAAGGAGAAGGGGCGCACCAGCACCGAGCAAGACGCGCTGTTTGTCTCTATCGCGCAGCGTTTTGCCATGCTTCGCGTCAAGatggagcgcaagcg
gcGCTCTACCCCCCGACCACAGCTTGCAGTGCTCGTGCCCCTTTTGCTACTCGCCCTTCGCGTAGACATCGAGACGCTTGTTCGTCTGCAGTACCCGGTG
AGCTTCTCTTGTGCCGCAGAAGAGATGGCCCGCCTACTTCAAGCCCTCGACACCCGGATATCGCAGCTGTTGGACCCCGACGCCAACTGGAGTCGTCTAG
CAGTCCTGGAGACAACGCACGAGGCCGGGCAAGCTCGAGCATCATCCACCTTTCAACGCGCACGGAGAcatcgacgtcttcgagacCAGTTTTTCCAGAC
GAGTGCAGTCCTGCACGACCTCTTCCCAGACCCTTCATCAGGGACATCTCGCCGCGTCATGACTctgcgtggcggcgctgggaTCAGCCACTACCCAGAC
CTCTCCAACGACGCCGCTGAATCTGCCCCctccacgtcttcgtcactcGCAGCCAAGCAGGAAGAACGCCGCCTACCAGACACCGTCTCGGTCGCCTCCA
AGCTCTCGCTCCTTCAAAGTCTCCGACGCTCTCAGCAAACCTAGCCAAACCCACACAAACAACAACGCCTCCCCCCCCCTTCAACAACGTACTAAATCAT
AGCAAATGGAAACGCCATATTTCTCTCTCAAAAGCTCAGAAAAAAAGGAAAAGATACTGCTACCAGCGCCAATGGGTCAGATCAGCCCAACCCCACGGAC
GCCGCGACAGAGCAGCGGCCTCTTTACTTGGTGAGCTGCTCCcagagcttctccacgtcgccgcgcgAGTTGGCGACGACACTACGGCCATCCATGGTGA
TGACCTTGccctcgccgtccacgaaGACCAGCATGGGGATGCCCGTGACGCCGAACTTGGTGCTCATGGCCTGGCTGGCCGTGCGCTCCTCGAAgggcag
cgccaagaagggcATCTCGCCAAAGTACTCGGAGTACTGCGCCGGGTCGCGGTCCGAagagatgaagacgagctcgAACTCCGGGTGCTCCTCGATCATG
TCGTCGTACACGGCGCTCAGGAAGGGCGTGAACTGGCGGCACGGCGGGCACCAGTGCGCGCTAAAGTAGAAGCccaccaccttcttgccgGCCAGCTTGT
AGTCCGTGTCCTGCAGGCCGTCCTTCGTCTGGATCTTGGCGCCGAGCTGTTCCGACCACTTCATGTTGcctgtgtgtgtgtgatTTGAGTCTTCTCCGGG
TTGTAGCAAGAGACAAAGTGAGAAGAGGGATTGAAGAAATGCGGAGGATACCGTGACGGACACAACAGTGTGACAAGATGTTCCATAACGAAAGCAAGTG
TCGCCACGTGGATCAGTAGTCGCCTTCGGACTGGGTGAGCAGCGGTGTTTCGTAATCCACGGGGGTACGAAACGTCAACCCGAAGAGTACCGTGAGGAAC
AGCATAAAATATGAACTCCATCATTACGCCCTTTATTGTCtacgtggagatgctgccCGCTGCCGCTAAAACGTCACTAGCAACTGGTACGAACGCTCTC
CAAACGAGCGACTTGATTGTAGGAAGTAAGCACGTCTGTCGGTCTCTGTATCTGCTGCATCTATTCCTCCGCAGTCGCCTGCTggtccagctgcttcttg
gcgttctcgcgcgccagcttcttggtcaaGTGGCGGttcagcggcttcttggacgggtcgaactcgcgcagcaccaccgtcAGGTGCGTGTGCGGGTGGT
GCATCACACCCGAGCGTCCTGGAATAATGCAACGAgcgcaacaacagcaacagttAGTTAGTCCGTCAACGCCCCCGCTTCTCCTTCCTGCAACAAAACA
CGCGCAGAGAGTTGCGCACCTCGACCCATGATCCGCAGGCGCTTGAGGTAGGTGCCCTTGTTCACGAAGCACTCGGTCACCTTGAGGTTCTCCGGCTCAA
TCTGGTACTTGATGTCGGCCAGGTTGATGGCGTTCTGCACCGTCTTCAGGAAGATCtcggccttgcgcttgggCGAGAACTTCATCTGCAGGATGGCCTC
ATCGGCCGACAGTCCGCGGATCTGCTGCGCCAGGTACGCCAGCTTGCGCGGGCTGGCGCGGATCGCGCGCTTCACGGTCTTGACGGTGCGCGCCTCGGCG
GGGGACGTGGAGCTCAGGAACGCGgccgtgtcgtcgtccgcagCGGCGGTCTCGCCCTCCACGGCGGTCGTGGACATCGTTGCTCGGGCCACGCGCCcca
tgaaggcgctgccAGCGGCCGGGCGGAGCGTCAGCGCGCCCATCTGCGAGCGCAGTGAGGCCAGCATCTTGTCCGGTCGGTGAGTCGCTGATGGTAATTG
AGAGCAAGGCCTCTCTGCTGCCACACATCGACAAGGATCTGCGGAAACCGATAGTTGGATGTTGCATCGGTTTGAAGAGGGTTATGATTCGAACAGTTAG
CAGACCCAGCATTGTTAGAATTTCTGGCTACATAACACATGGCTACACGGGTTGAAGCAAACTTTCTGCCTGCAACAGCGTATTGTTGAAGCTCTCAACA
AAAGGCTCTCTAACTAATTGGCGGAGTGTTCCTCCCGCTAGGCAGGACTTGATAAATGACTTAAGATGGGTTCTGCCTGCTGTCCCCCCGGCATGAAGAC
GCGCTGACTCGCCTTACGTCACCACATGCAAATACCGTCCGGCAAGGACACTCACGCAaacggcgacgtggtgcgcgtcttcttgtcAGAGATCCAGATG
CGCAACTTCTCTAAGTTGTCCGGAGGGTCGTCGTTTccctcttcgtcgccgctggcatACGCGCCGGCGCTCATTCGATCTACGCTAGCACGACCGGCAG
CGTTGATGTGgtccgcgtcgtccggcAGCCATTCGATGTTCACCTCGATGTCGGTTCTGTTAGACACCAGCGGCATGAGGTATGACACGAATCGCTGACG
AGCCACGGGCGGGAGGGATGGGATCTCGATACCGCGCACTGTGATTTTAGCCGCAGAAGTACCCACTACAATGTTGGCAATCCACTCGCCCAGGTACTCA
AACTTGTCGGGTCGTCCCTTGCAGATATCACGGCGAAGCGACAGGAGGAACTCGGGCGTGAAATACTTGCACTTCTTCTGTAGCTTAAACTGCACGATGG
CCTCGCTCAgcgcctgcatctgctccgTATTCTCCATCCCGTGCGTGCCCACGTCATAGCACTCACTGCACAGGTTGTAATTTGAGCATACGCTGCAAGT
CCAGAGCGCACCCACGATCGGGTCCATACCACAGCCATCGCAGAACGAGTTCGGATGCACGATCGTTTTCTTGCGCTTCCACTTGGAACCAATGATGGAT
GCTCCCTGGCTCATAGCTGCACCCAGGCGCCCCATGAGCGGTTTTCCTGCAGAGTGTTTCTTATCAGGTAGGCTCTTGGACTGCGCGCCATCCTTGTCGT
GCAAGTCACGTTGGAACACGAGTGTACGCGGGACTGTAGACGTTTGAATGATTTCGAACACCTGCTCCTTGGTCATATGCGGTTCGATATGCTGACCATT
CACGCTGATCAGATAATCGCCCACTACCACACCACCACGCTGCGCAGGACTATCCTTCTCCACACTCCAGACCTCGACTAGTAGCTCGTTTTCCAAAGAC
ACGACGACGTTCGTGTTGAAGCCCAGTACTTGATCAGTAAACGTCAAGGTGTATGTGTTGAGGGGATTTTCCATGTAGTCAGCTTCGGATTGCGAGCGCA
GACCAGACTTGGCGTCTGGGGCGTGAATTGCACTTGCACTCGACGAGTTCCGTCCCGACGACTCACCGCTACTCGTCACACTGCCCGAGCTCGCTACTGC
CGATGCTGCCTCACTAGCGAAGCGAGGCGGCTTGTCATGGAGTGCAACATGACGCAAGCTATGCAGTGCACGAGCGGACGACGGGTCAGAAGCCACGCTT
GGACCCAAGAAGCGATGCGAGGTAAACTCGTCTTGACCCTCACCAAAGtccgcggcgccgccgtaACCCAGAGGGGTGCCCAAGTCGGCaccttcctcgt
cgtcttcgcctgcagctcctccttccATCTCGTCACTGTCGCTTGCCTCGTCGTCAATATCGTGATGCACTAGGTTCAGTGGGGCCGGTCGTTTCGGGGA
CGGGATCACCAGCTCCACTTCATGCTCCTGGACCTCGTCATCCTGCACCTTCAGTTCAACTTCACGAACCTGCATCTCCACGTTTTCGATCTCTTCAACC
CCGACAgattcagcagcaggcgacggTGGCGGAGACTGCACCTCCGTTTCGCGCTCCTGTACcatcagctccttctccactgcagctgcagctgcagtct
cGTCCTCAAAAGTCTGCTCAGGAGGATGCTCCACAGGTGTCGTAGGCTCTGCGTGGGCCTCcacgggcgtcgtgggctcttgaacagcagccaccacctc
ctcctgcgtgtgcagctcctcgtcctcgtcgtcgctgtctgtACGCGCCCTGTCCGActcggcgccgtcctcgtggggcttgtgcagctccagctgcgcc
gccacggggctcttctccgtctccacctcggccacgtcgctctcggtTGGGGTGGACgggctcgccgctgccgcttcggGCTCTCCAATGGCGCGAGGCG
ACTCCGCGTGGGGTttcacgagcgacgccggcgcctcCATCTCTTCTGCCTGCCTGGTGCGCGCTGTAACGTATAGTGGGCAGCAACTTCCGTTCAGTAt
ggaggtcgtcgtccgttTGCTGA