Description :
From Genome Similarity Track
Location :
Scaffold_13:262899- 264297
Sequence
1398 bases(100 bases per row)
CCGGCGTAAGGCGCCCGCGGCTCCCTCGAGCTCGTCGCTGATCAAGTCGCCGCTTGCACGAGACAACTCCTCCGCTCCAAGAAGAAGGTGGGCGTGGGTG
CGCTCGTCGTGTGAAGCGCGGCACGCCCCTCGTGATCGAGAGCCGCCGCGGCGGAGCCCGTCTCGATGCTTTCGATGTCGCCCGAGCCCGTGGATGTCCA
TCCTGCAGAAGGAGAATCGCAGGTCTGTGGAGCTCACCGTGGGCACCGCGGCGCTCAGGTCCTGCTACGGCAAATGACACCCGTCTGAATTTCGCTGCGC
TGGCGACGACTTCGGCGTGTGTTGCGCCCTAGGCCCGTGTTCCCGTACGACGGTCAGAGGTGGCAGCTACTGCTTCCCCGCTCACGAGCTCTTCGGACGG
AGACAAGGCGTTACGAGTCGTAGCCTACGACGCCGTCTACGGCGACGATAGACGCGGACAAGATGAATGGAGCATGAGGACACCAAGTCCATGACGGCGG
TCGGCCGGCCCGCCCACGCCCGCCATCGCCGCAGCATTGACCTCGAGTATTCCACGACAACTACAGACTCAAGTTCGCCCACGCTTCGTGCAGCTCGACA
TACTGTGCTGTCCAAGCTCTACGACGAGGATTCGGAGTGGTGGGGAAGACGCAGTTCGCCTCGTTGATGAGTTGTAGGTCAAGTCTCGCCGCACTCCCAA
GCTCTACATCCAGGCCAGCACGTTTTAGGGGCACCCGTGCGCCACTCCGCGCACCCGCTACAAGAAGGAGAAGGATAATTCGTGGCACCCAAGCCCGTGA
CTGCGTATAAGCTTCGCCAAGCACTTCTCGTCGGTTGTCATATTCGCTACGGAGGGGATAAGCTGCAACGCGAGGTTCGTGCAGGCGAATTCTTCACCCT
GCAGAGCGCTGGCATCGCATGGGAGCGCGAAGCATGTCAAGCGGCGTGAACACTGAGGGTTGGCTGCCATACTGCTCGAAGGCGCTCGCAGGAGCGACTA
GACCGTGCTGCCTTACACGGTAGCGTATAAGTCATTGCTACGTCCAATGCATAGTTTACATATCGAATCGAATACAGTTGCCTCACTATATAAGAGAGCC
CATCATGTAAGGTTACCGTCTATGCATCTTGCTGCGACTACCAGCTCGATAAAGCAGCAGAATACTGCAAATTGAGGTGCAGGCTTTAAGAAATGACTAA
AGACGTGATTGTAAGGCATCGGGGCCTTGCTACTGCATAATGTCTGCTCATTCAACGTAGACCACCTTCATCTACAAGAAGTCCTGCCATTACTTGGCAG
GGCAGAACGTTGAACGGAGCATGGAGAAGAATTGTCGTGTCATGTTCCACTTCTGTGGGTGTTTGGTTCAGGTCTACCGATTCGGTCTCATAATCAGC