Description :
From Genome Similarity Track
Location :
Scaffold_175:26286- 28068
Transcript NameFunction/comments
g14243.t1hypothetical protein

Sequence
1782 bases(100 bases per row)
ATACTGTTCTACTCCGCGACTGTAGTGTGGCTGGTGCTTCTGCGTCAGATTGTGGTCTTCTGTCGGTTCTTGACACATTTGAAGCTGCAGGCAGACAGCT
CGAATGATTCGGCGCACACATCTTCACTTGGCAACTACTTCAACAAGCTGTCGCTTCCAACGATAAATGAGCGAGCACGGCTTGTGAAAGCGTTCAAGAA
GCTCCTGTATCGTGCGGTCGCTCGTGGGGACGTTCTTACTGTGGAAACGCTCCTGTCCGAGTCCCAGTCAAAGTACAAGATTGACCATATTCAGGACTTG
TACAGGCCGCCAGTGCTGTGGTTTTACGCTTTCGCGAAATCGAGAAAGAATCCGCTTCATATTGCCGTCAAGCGAGGCAATATGAGGATCGTGCAGATGC
TGCTGGATAGTGGAATTGATGTGAACGTACTCGACAAAGTAGTGCGGGTGAACTTCAATGTTGGTCTTGTGTTTAAGATCTTCAGTCGCATCCTGGTAAG
CTGCGAGTGCTATTTGCTGTATGTGCAATTGTACACGACTAATATTTTTTGTGCTTGCACTTGCGTAGGTTCGAACGCAAGACGGAGTTCGATCACCCCT
CAAGACGCTCCTATGCTCCGTTCTCCTTCCTCCACTTCACGGTGCAGTAGCCGAAGGCTACGTTGATATTGTCCGTTTACTTATCAGCAAAGGTGCTGAC
GTGAATGCTCTCCCGCGCGCTTCGTTTTACTACCCGGCAGCCGTTCTTCCACCTATATTCGTGGCGGACGACCCGCAGGTGCTGCGCTTGCTGGTAGCAA
ATGGCGCCAACTTCCTTCAGGTTGCATCGGTATCGCTGACTGGTTTGATCCGCACGTACGCAACGCCGCTGCAGCAGAGTACGTTTACATTGAGATCGGA
TCTGAGCGATTACTTGCTGGACTGCGGTGGTGACGTTGCACTGACACCACTTCACGAGGCAGCAGCCACTGATAACGTCGGAAAAATTAAGTGGCTGCTC
GCGCGTGGCATTCACGTGGATACGCTGGGAGAACGCGTTGAAGGTGTGCACCGTCGGACGCCGTTACACTGGGCGGCAGTTGTTGGAAAGGTAAACGCCG
CCAAACTCTTGCTGGAAAAGGGTGCAAACCCCAACGCAAAGGACCGCGATGGCCGCACGCCCTTGCATTGGGCAGCCAGAAACAATCACGATGAGGTAGT
CTCCTTACTGCTCGCTCACAAGGCTGAGCCTGATGCGGTTGATGGTGAGGGCATACCAGTCGTGTGTTTTGCGGCGGAAGCTGAAGGTGTCGATTCGACC
ATTTTCTCTAACCTGGTGGCTGCTGGCGCGAGTCTGCGAACCCAAGTGTCAGGCGGAAACACTGCGCTGCACATCGCTCTGCAGCGTGAGAACCGGCAAA
CAGCAGTATCGCTGATCAAGTGTGGATCAAGTATGATGATCACGAATGATTCGGGCAAGCGCGCTGTGGACTGCACGACGTCTACTGAGCTGCAGTTCTT
GCTTAAGAAAGAAGCAGGAACCCGCAAGATCATGATCTCGTACACTCACACACATGCACAATTAGCGCAAAAAGTTCGCGAACATTTGGAAACACAAGAG
CAGCTCACGTGCTGGATGGATACCATGGATCCTAGCGGAATTGGCGGTGGCGCGGTTTGGCGAGAGGAGATTGCGCGCGGTATCAACAACTGCTCGCTAG
TCCTGAGCATTGTGTGCGACGGCTACACCAAGTCTGAGTGGTGTCTCAAGGAGCTTGCGCTAGCAAAGCTGCTCCGCAAACC