Description :
From Genome Similarity Track
Location :
Scaffold_107:26285- 32821
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_107-snap-gene-0.50Importin alpha-2 subunit
Pytap_DAOMBR444maker-pag1_scaffold_107-snap-gene-0.25MKIAA1841 protein
Pytap_DAOMBR444maker-pag1_scaffold_107-snap-gene-0.26Conserved gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_107-snap-gene-0.2733 kDa chaperonin
Pytap_DAOMBR444maker-pag1_scaffold_107-snap-gene-0.51Vacuolar protein sorting-associating protein

Sequence
6536 bases(100 bases per row)
CCGAACTGGAAAACATTGGGCTGAGCACCAGCACCGAAGGCGAACTGCTGGGCGGAGGCATCCTCGGCTGGAGCAAGGCTCTCCTCGACATCCTCTTCGC
CCTGGAAGTAAGTCTCCACGAtCTTGAGCGACTTCTGGTAAATATCTGTGACACAAGtGGATCATTGAGTTGCCAGGCAAAGACATCAAGCAGGATTATT
GCACACGCACCTTCATTGACGTGGTACTGCAGCTGCTGAATCTTTGGAACACCTTCAGCTTCATCAATAAGAGTTGCCATTGGGTTGAAGTCACCTGGAG
CcTTTTGGCTCTCACCGACGCGAAGGATGTTCTCGAGCCCCTCAAGGGCAACAATCACAACCTTAGCATCGTTGGCCGCAAGAAGGTCACACAGAGGCTT
GATGCATCCTGACAGAGGCAAACGGGGTCAGATCAACGATCGACTGATCTACGACGGTCAaATGAAaTTGACTTACCcTGCTCGACGAGGTACAtGATCt
GTTCTGGAGAGCCACCCGAGGTAGCGTTCGACACGGCCCAAGCAGCCTCCTTACGGATGTCAAACTCAGCAGTCGAGAGGAAGTTGATGAGAGTAGGGAA
GATACCCTCCTCGATAACACGCTGAATCTGGTTCTGGTTACCAGCAGTGATGTTCGAGAGCGTCCAGCACGTCTCCTTTCGGATGCCCTTCTTTGGGCTC
TCAAGCAGCGAACGAAGGCATGGGAGAGCCTGAAGGTTGATGATGACCTATAGTGAGCAGAAATGACGTGTCAGTACGGATAaGAAGCCAAGGACACTGT
TCTAGTCGaCACATACCTGCGTCTGAAGATCATCACCCGTAACGATGTTGCCCACCGTGCGAAGAGCTGGGGTCTGCACAGATGGGGATGGGTAGAGCAG
AAGCTCAACAATACGTCTGCAAACGCCTGCCTCAATGACAGCCTGGATCTTCTCGTTCGTGCCATCCGAGAGGTAtGAAAGAGCCCAGCACGCGTCGGTC
AGGACTTCCTCGTCATGCGTGTAAATAAGCTGGCCCAGAGTTGGAAGTGCTGGCTGGACGAGTTCGAACTGTGGCTGAGGCTTGCCAcGGCAGAAGTTGG
ACAGCGTCCAGGTGGCGTTACGCAGCATCGTTGGCTTCGAGTTCTCCGTGAGCTGACCAAGGAGAGGACGAAGGGCACCaCAaCGCAGCACCATGTCACG
GCACTCGACCGAATCACCGGCAATGTTACCGAGAGCCCAGACGGCCTGCTCGCGCACATCATCGCTAGTCGAAAGCAGAAGCTTGCAGAAGATCGGCACC
GCGCCGTGCTGGATCACCACGGCGGTATCGTCCGAGGTACCCGAGGCAATGTTGGTAAGGGCCCACGCAGCCTCAAACTGAAGCTCTGGGAAGTCATCGC
GCTGCAGGAATTCCACGAAGATTGGCACAACGCCAGTGCGGATCACCTCCTTGATTGGTGGGTTGCGCTCTGCAAAGCGATCTGTAAGCGGCTGTGCGCA
ACAGTCGCATTTCATTGCTCCACTTACCAATCGACAGGAGCTTACGGAACTTGGTCACAGCGTCGAGCTGCGTTGGGCCATCCGTCGACTGCACGCCAGC
CACCATCGCTGGCAGTTCGTTGAGCTACACACCACACCGTGAGTGGCCACATCCATCCATGCAATCTAGAATATTCCGTACTCGAGCCGCGAGCGACACC
TCGCTGCCATCGGTCGCACCGGCCACACCTTCCATCTGCGTCGACCCAAAGTCCGCGCCGCCCTGTTCCCATAGTCTTCTGGTGAGTCCCCCACCCTCTC
CTGCGTTCTGTGCCCCTCAACCCATGCACGCACCATACGGCGACGCTGGTTCAGGCGGTCCTCCTTGACCGTCTTTCGGATCTGCACCGTGGTCTCCAGT
CGCTGGCGTCGCGACTCATCGGCGTCGATGGTCTTCTTGAACGTGCTCTTGCGCTCCGGCACTTTtCCCCCcGCGAACGACATGCTTCGACGTTGCTTCT
GCTTCTCCACTGGGGCTTTTGCTCCGATATTCTTTGGTGGAAAAGCTCGAGCAAGGATTCACCTTTGCACCTCGCTGGTGAGGTTCTGGACTCGACCAGA
GAATAAAACCTTACGTGAGAGATGGGTGCTGAACGGACTCAGACTCAGACCAAGGGgCATCTTGAAAGGGCACCACcGCATGCACATGACGAGAGGAATG
GATGGAGCCcATGAGTGCGAGCGCATCGAGTCGCCATGTtCTCATCCATGTGTTTGATGAGTATCGCAAGGGCGCCAaGgACTTTGTCTGCCCGcGTGAG
CTGCTGTTAGACAaGATGAAGTACTTCCGAGCGTACCTGAACCAGTCGAACGAGCACGATGAAATCGACATCTCGgTGCATtGCGATGTTGAGATCTTCG
AGTGGTTGGTCGAGTACATGCAGCAGCGAGACGTGGACCAGCGACCTAGCATTACGATTGAGAACATTGCATCGATATTGGTTTCCTCCGAGTTTCTACA
GATGGATGCACTTGTCGACGAATGCATCTCGTTCATAGCCAGTCACATGCAAGAGTTCCTCCAACTTCGAGTTGACTTTGGTtGCATGACCGACAACACA
ATCGCAAAAATCGCTGAGCGATGCAGCGCCGATGAGTTACAGGAGCTACAGGATCCAAAAGaCAagATtCTGTCCAAGCTCCAGCGGAAGAAAGTCGAGA
TCTTGTTGCGAGATCTTCAACAGAGTGAGTCACCACTTGCTGTTTGCGCGAACTGCGAGGCACTCTAcccATCTTGCCACGAAGAACGACTGCATTGCAT
CAAAGGAAGTCGAAACCTTACAGTTCGCGGTGAGCTCATAGCGAAGCACCAGGCAAAGACGCCATGGACAGGTGACGATTGGATCCGACGAGTCGTCCAA
GAGAAGGGAGTGACGTGGGGAGGAGTGTACTGGTTTATATGGGCCACCTCGCAGTGCTTTCAGTGTGTGACCTGCCATCAGACGTGCAGTCTGTTGAATT
TTCGTGATTGCGCTTACCATCCGGGGTCCgCAACGGGTACTGGGACTGATGCGAGGTATGCATGCTGTGGCACTCGCATTTTCTTtGGTGGAGAGTTCGA
TAGTGCTGGGTgCAAGACGCGTGATCACACGCTTTGCCCCTCCGACACGGTGCGACTCGCTGCAAGCGTGAAGCTTCTTATGAAGTATTGGGATCTAATA
ACGAAGACAAAAGCATCCGTCcTCCCCGCCAGTAAGCAGCCAGCAGCACCGCACATTGACATGTCTGTGGTGCTGGGACTACGgCCTACAGAACCAGCAC
CAGAGCTTGAAGCTGTAcTTCGGAAGGcAcTGCCTCCATtCGCCGACGCTGCGTCGCCGCGTAGACGCAAGCAgTGGGAGACGCTGCGCcTACAGGAGCA
CGATCGCGTACGCATGCAGCTCCTCACCAAGCAACTCaTCCAGTTaCGGAAAAACCTCACTACTTGAAGTGAATAATGATATAATGACAACTGATATAAa
GAATGACCATCAcTctcATCGCCACCTCCAACAAAGTCGAGTGAGTGGGCTGAATCGCTTAGATGCTCCGTCGCCAACTGCTGCGAGACGTGGTGCTGCG
CACTCACGTGGGCAACCTGCGCGTGTCGGCCGTCGTGGCTCGCAAGACCATTGCGGAGGGTGCCCGCCGATGGCAGTTGCCCACGACAGCTGAGCCCAGC
CGCCTCTGGTCCGAGTACATGGTCGGCACCGTGATGCTCGGGTCGTTCTTCAAGGGCGAGGAACGCGTCAAGATGGTgcTGCGCGCGCCAAACAACGAAG
AAGTCTACGTCGAGGCCATGGCTGTTGGCGAGGTGGGTTGCATAGAAGTGAGAGCAATGAATGAGGAGCTAACAGCTGGGGCAGGTGCGAGGCAAGGCGT
CCATGTTCGAGGACAGTGATTCTAGCGTGTTCGCTGAGAGTAGGTGCCCATGGAACCAACCACAATGCATCATTTTAGTTACTCACACGCGAGGTTATCA
CGCAGGTCAGATGGAGGTCTCTAAGATCCTCTACGGGGCTACGAAGCCATACGTGACGACAGTGCCAGCGACGGGTGTCCCGCAGGCGGATTGGCAAACA
TTCTATGACGTGTCAGAGCAGGTCCCAACGATTGTGCGACTGGGCCACGCCTTTGAATCGGATGAGCTCCGCTGCTGTGGTCTCACGATCCAAAAGATGC
CCGAGTCTGCACCACATGATCGCATCTACGATCTTTCTGATCTCAAGTTGGACTCGGCGCCATTCTCCCCAGAGGATCTTGCAGACAAGACGAACCTCCT
CGAGTACTTGAACGAGTTGATTCCGCATGCAGATCTGACTGAAGAAAAGTGTCGTCGAGTTCCACTCGACTTCTATTGTCGCTGCTCGAAGAAGGGATTT
GGCGAaCGCCTGGCTGGCCTTGGGAACGAaCAGCTCGGTTtGATCATTGATGATACAGCTGAGAAGGGCATTGAGCTCACTTGTCATTTTTGCAACGAAA
TGTATCATTTCTCGCTAGGAGATCTTAAGGCAATCCAAGCGGATATCAACGCGCCAGCGAGTAAGCTGTAGATCAATAGATGCTCAGCAATCTAGCCGTC
TTGGCCAAATTCTGAAGTCCACTTGACGAATCGATTCAACTCATCTGGGGCAACACTACTAACTGAGTGTTCCATAACCTTCTTGAAATCGTTCTGTCAA
TCAGGTCAAGTTTGTGAAATCACGGCGCAGGGCAgTCCAGATAATTTGAAAACAGCACTGACCATCGAGACGACTGGAGgTCGAAGCTTGTCATCCGAGA
AACCACGGCTTGGTAGGTCATAGAGAcGCATTCGAAGCGAACCACATCGAcGACACGGTGCCTTGCACTCTGTGCAATCACGCGGGCATGATGACAGCTT
CATGTGACAGTATGCACAAGGCGGGTCATCATTACAAGGAGTGACATAGGCCCCTCCAGGATTTGGCACTGCTTTTTCATCGCACTATGAAACAGAAAAC
TGGAAGCGTGAGCCATGCACATGCCGCCCCGCATGTCCGTTTTACTTACGCGCATAAAAAaCTGTGCTTGCTGACATTTGCGCAAAGGCTCCATGAGAGC
TTCGCGCACAAGAACAGAGATATCGGAACCAGAGCACCTGCGTCAAGGAGATCGTGAGGCAAATATTGAGGCGATAACTGgAGAGGCAACATACCCCTCC
GTCTTCTGTGCGATTTGGTCAAAGTCTTGCTCAGTCAGGGCATGAGGTGTATCTCCTAAGTGAAGTTTCAGCATAACTTTtCGTGCTTCAAATTCCGGAA
GCGGGATGTAGATTCGCTTTTCAAATCTACCACAGTACAGTCAGGATGaaagaaaCCTCTTCTtTTGCAGACAGTTTACGTACCGTCGCCGCATCGCTGG
ATCCAACTCCCATGGGACGTTtGTAGCCCCcAGGACGAGAATACCGTCATGGCTATTACCTACGCCTTGCATCTGCACCAAAAaCTCGGTCTTGATACGT
CGAGTTGAGTCACTTTCACCcTCGGTTCTGTTCGAGGTTAGCGAATCGATTTCATCAATGAAGATAATCGATGGTTTCTTCTCACGAGCCATCTCAAACA
AATTCTTGACCAATCTGGAAGTaTACAGTGATtAGCATTTGATAACGCACGAAGCTGCTCAGATGTTACCCACTTCTCACTCTCACCCTGCCACTTAGAG
ACCAAGCTTGACGATGAGACAGCAAAGAAgaTTGAATCGGCTTCTGTCGCGACTGCTTTGGCTAGGTATGATTTACCTGTACCTGGTGGCTGCACGCTTC
GGTGAGGAATAACGATCAGTTTCaCAAGAGCAGTCTCTACGCACCCCATACAACAAGATACCCTTCCATGGTCGGcGTTTCCCTGTGAAGAGCTGAGGGA
ATCTTGCAGGTAAGATGACAGCCTCTTTCAACGCATCCTTTGCGGCATCTAAACCAGCAACATcGTCCCACTTTACGTCTGGCTTcTCCGACACGACGGC
AGCTGAATGTGAAGAGATCGAGTAATAAGAACCTGAATtCACCGAGCCAATAACAAGCGCTCGTACATGCTAACGACCCCCGCAGCTTCGCTGTCTCTGC
ATCcGTCTCGTCGTCGTCACTCTTGTCACCCCTGATCCATTTTCATTTCATGTGAGCGAGATGCCATACACAGCCGAGAACTGATGACCACGTACTTCTC
AAGCTCCGCTGTGCCTGACGCGCTGATGGCCTTGGGGCCACCCGCAGCCTTCTCCAGCATTTCACGCAGCTGCTCTGCGCGCGTCATGTACCCTTCTACA
CGCTTCATGATGAGCTCTTTGGACgTCGGGTTCTTCTCATCTGCATaCCAAATGTCTGCGTTAGCTGCCTCTaCCGGCGCCTCGTTCCTCcGCCcTCCCG
TACACTTGACGCCGACCATGAAGTGCTCGAGCGCCCGCTTGTAAAGCGCGAATGCCTCCTCATAGTTCTTCTTATTGTCCTCGTTGATCGCGAGCGTCAC
GATCTCAATGGCCTGCGGgATGAACTTGTTCTCCAT