Description :
From Genome Similarity Track
Location :
Scaffold_24:262802- 272158
Transcript NameFunction/comments
Physo_133097hypothetical protein
Physo_133098hypothetical protein

Sequence
9356 bases(100 bases per row)
GCAGCCCGGGCTGAGTAACTGCGCTCGGTCTTCTTCGGAGTTCGCGGGAGCGGGACGCGCGCTGGGTCAGCGCCGCCCTTGTTGGTGCGAGCCGCCTTCG
GCTGTTCCAAAGAGAAGGGGGTCACCCCGAAGGCTGACACAACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAGTT
GACCTGCAGTAGCACGAGACACAGAAGGTCACACCAATCCCGGGTCGCGGCACCAGTCGTCGTGTAGGAACACGCACTAAATTATATAATAGCACACTTT
CCCCACCAACAACACCCACCAAGTCCCGATGACTCAATGGGCTTGTTAGGGTTAGAACCTGAAGGCCCAGGAACTTTCCCTTGCACCGGGTTGACGTTTC
CTCTGTGCACCGTGTTTCCGCTTAGTCAACTGACGGAAACCCAGCGTCACCAGCCACGAGCAAAGGCTGGCACGCTCTCACACACAATATAAACCTCGCA
GACCCTCAGGAAGGAAGGATCCCAGCCAGTCACGGCTTGATACGAGGGTGCCGGAGCTATACTCCGGCGGGAAGGATAAATGGAGTGCGCTCTCGCTCCT
CTACTACACGGCGATGACTCGCCCTTCGTATACACGGCCACCTCTTCTCTTCTCTTGGCCTGACCACGGGTAAACGCACGCTACGATACTAGCAGGCGCG
TCCACCGACAGTCATAATCCTACCAACAGGTTTATCCAATTGCTACGAGAACTCACCGATAGCCCGGACGTCTTCCTTGAGTGGTTGGGAGGAAAAGCTG
TTCTGCCATTGTTGCCCAAAGGGCTTATCTGTTCTATCTTCTCTTTCCTACAAATATCTAGTCTAGACGTGTCCGTTGTGGATCTTCCAGGTAACCACCC
GACTCTTCAGAACTCTCTTGAAGGCTCGGACGGCCTCCCGATGACTCGAAGAGTCGCCTTAGGTGCGGAACCCAGGCCAAAGTTCGCCGTAGGTTCGGGT
CGTCCTTGAAGTCCCGGTGTTGTGTGGACACACCACGGCTTAAGCTTGAGTGTCGACGAGTCATCATCATTGGTCCAGACTGGCCAATCCGCGGCCGTCG
AACACCATCGAACGAATGGCGATGTGCCTCGATCCGCCAGTTGAGTCGACGCCGAATGCCGCGGGGCTTGCCGTGAGCTTCACTCAACTTTCTCGACACC
ACATGAGCGAGAAGTTGCTCGGATTGAAGCGGCTCGTGTGAAGGTAGTCCAAAAAGCGGAAGAAGCCGAGCGGAAACTGCTCGCTAGGCAGGAAGCGAGT
AGACTCCGAGAGCTACGCAAGCACGAAACCAAACTGCGCAAAACAGAAGAACAGCAGCGCAAACGAGATGCGAAACTTCAGCCCCAGGCTGTAGTTCGAC
GAACGCAACCACCGCCAGCTCAACGGAATGCGAAGCGACAACGTAGCGACGAAGACTCGGCACACGATCCTGTCAGGATACTAGAGTTTGCAGACATGTA
GATGAAATGTCCCGAGATTTTGCCTTGCCAGCTTGCCAAAACCCATATGTTTTGGGGTGTCAAGTTGGGTTGATTGTCGTTGGAGGCGCTCAATAATATG
TGAACTTTCTAGACTGACACAGCTCATTCAATACATTCGTTTTGGGCGTGTAGCTTTCCGATGGTGTGCGCACGGCTTCATAATTCCTAATTTTAGCAAC
ACAACAACAAAATTTGTGGATTTGGGTGGCAAATTGGTGCCCTGTACTTACCGGTTCACGAGTGGTACAAAGGTTGCTTCAATGTCGCGCCAAAAAGCGA
TGTTGCACCAAGAAAGATTGCGCGCCGGGTATCACCTCGATTGCGCCCACTTCAACGTCTTTGCTTCCATGCCATTGCGTGTCGTCTCCTCGCCCTCATT
TCTCCAAGAATCGCCTTGCCCATGGTTCGCGTTGTCATCTTCAACGCCGACACGACGCACCTTCTCGGCAGTTGAGCGCGTTTTGGTCGCCGCCGGGATG
CCGCACTCCCCCGTCGTGTATCTACAGGAGCTCAACGAAGACGTGCATGTACTCGGAGAGAAAATGCACTTTGAGCACGCTAGCTTAACGTCCAGTGCGC
GTGTGTTCAAGTTTGGTCAGGTACACTAGTTGCTCAAGAGAATCTCGACGGTGTGGTTAACCTTAACGCAGGGGGATGCTTGGCAGGCAGAGGATGGCGT
AGAGAGGACGGTGGGGCCTCGCACGTTAGCCCAGGTCGGACGCTTCGCATCGAACTTGATTGCGCGGCGTGCTATTGTGGACTTGCCGGCTTGTGCACTA
AAAGTCGAGAATGAAAGCGCCACCATCCGCATGAAAATTCGCTTGGTGACGTTAACGACCTTGCCCTTTGTCCGGTTTGCAGCGGCCTCTGCAGCGAAAC
CGTTGACCTCTTGCTCGGATAGCTTACGCTGACCCTTGAGTGACATATCCCGGAAAGCTATCAGCTCTTCTGCAGTCATGCGTACGTAGCGCGGAAACCC
GTCCTGAATAAGATCCAGTGCCTCTTCAACAGATAGCGGAGGTTTCGGGCGTCGAGTCTTCACCGAAGGTGTTGCTCTTCGAGGCGTCATAGGCACCGAA
GCTACTGTAGGCGTCGTAGGCGTCGAAGCTGAACTCGTAGCTGCTGAAGGTGCTGAAGTCGTCGTAGCTGCTGGAGGTGCTGAAGTCGTCGTAGCTGCTC
CGCGTGACGTAGCTACTGCTGAAGTCGTCGTAGCTGCTGGAGGTGCTGAACTCGTAGCTGCTGAAGGTGCTGAAGTCGTCGTAGCTGCTGGAGGTGCTGA
AGTCGTCGTAGCTGCTCCGCGTGACGTAGCTACTGCTGAAGTCGTCGTAGCTGCTGGAGGTGCTGAACTCGTAGCTGCTGAAGGTGCTGAAGTCGTCGTA
GCTGCTCCGCGTGACGTAGCTACTGCTGAAGTCGTCGTAGCTGCTGGAGGTGCTGAACTCGTAGCTGCTCTGCGTGACGTAGCTGCTGTTGAAGTACGAG
CTGCCTTCGCGGGGGGTGCACCTTGCTGTTCCCCCCAGAGGCCCTCGCTGTCCCTCCGACGCTTGGGGATAATCTTGTCAATATCAGGATTTGTCGAGCG
CAACTTGCCAGCGGCTTCTTGGACTTGACGTTCAATTCTATCTAACGCGTTCCGTGAGAAGTACAATCGCGAACTAGTTGGTAAGGGTATGGGGCAGTTC
CACAGCGACTTTGAGCTCGATGGCTCTGAAGGTGAAGTATTTGCTACTGAGAGCTACTTCATCGGTAAGAAGACCTATGTAGACTTTCTAAAATGCACTG
AGAATGATGTTGAGGGCGTCCACAAGCGCATGAAGGGTATTCCAAGCAAACTGATCACGGATCCTCGAAAGACCTATAAAGAACTTTTCGATGGCATCGA
CCAAGAATTTGACATGACTGCAGCATGTCCAATTAAGATCGATAACAAGAGCCAGCGTGTCAGCCGAAGACAAGCATTTACACGTATTGTCAAAGCTTAA
GTAATGTAATATAGCAGAGTTTAGACCAACATGGAAACTCAATACGTAGATGATTTCAACGAAACGGAAGAGGCGTATGATAATAATTACGAAGAATGCA
TGCAGAGCCCAGTTAAGAAGATCACTAAAAAAAGAGAGACGTCTCTACTCGTCCGGTCCGAGGGGTCGCAGCCGCAGGCGAATGACCCCTGGGGGCATTT
CGCCAGAGCGCCAGCTCTATATGAATTTAATGATATTGCTACTCGTGCTCGTCCTCTATCGCCGAAGCAAAAAAAGAAGTACCAAGGACTTCTGACTTTG
CATCCAGACAAGCTGATGTTTGGAACAATTGAAGATTATTGCTCGTATAAAAAAGCTTGGAGCGTAAAGTCGTCTCTCCACCAATGACTCTACGACCCCT
TTACCTCAAAAATCGCCGGAGAGATCTTCCCAGAACGTATTGCGGTACTCTGCGGAGAGTATTGTTGTAAACTCTATCTTTTCAAAACATCTTATGGAAA
GTATAGCTAACTGCAAACGCTAATGATTGGCTAAAATGTGAACTAACTTTTTTCGCTTCCATTCCTGAACTCGACAGTCGGAGCACAGCAACGATGGAGG
TGCTTCTCGCTGAAAATGCGCTGCTACGTCAGCAGGTCCAACAGCTAGAAGCCCAACTCACCCACGCGCTGGCGCTGCTGGATAGTGAGCGCCAAGAACG
CGCTGAAGACCTCCGCAGCCACCGCCGCGAGAGACTGGCTCTCATCAACGATATCGGCGGGAGGGTTGATGGTCTTCTAACCACGCATAATGAAACGAAG
GACGCTATCATTGACCGTTTGGATACACTAGAAGGCAAACTCACCGACCCAGAGCGACGGATTAATCAGGTTGAAGGCGATGAGGAGGTGATTGTACCAT
TCACCATGGACGGCAATCCGATTGATTTACGGAATAATTTTCAGAAGGAAGCTACACGGTCAGTCCGGGCAAATATTGGTCGGGTACGTTCAAGTCCAAG
TATGGAGCTTAACAGGTACCATCAGGGCAGGAGGAAGCGGGCGCGAGAGGAATCGAGTTCAAGTGTTGCAGGTCGAAAGTCAGCCAAGACCTCATCGAAG
ACATTATTAACCGAGTCCTACTTGACTGCATTGCGACGAAAGATTGACCGAGCGCTTCGAGTATCTTCTCACCAAGAATGTAGAGGATCGTCTCCTGATG
TACCGCATTCTGGACCAACAAGCGAACGAGACTGCCGCTGAGGTTCAACGGCAGCTGAATCAGGATGCGGAGCGCCGCCGGAGAAAAGCGGAGGAGGAGG
AGGCGATACTCCAACTCCATGCCGACGAAGAAGCGAACCAATTTTGGCGACAGACTGAAGAGCAGGCCCGTGCAGAGCGAGAGGCAGCCCGGATCCAGCA
ACAGAATGCCGTGGCGGCGGCACGACGCGAGCTGGCGGCTATTCAGGAAGGTTTAGCTCTGGCTGTACAGCTCACTCGCTTGGATCTCGAAGTGCAGATG
CTACGGAGCCTTGGACTAGATGATCGGAGCCGCAACGCACGCAATGCCTATCTCTGGTTACGGAGCATCGGTGGATTTTAAGGTTGTTGCTGCGTGCAGG
CTTGTAAGGCACACCAGAATAAAATCTTGCAAATCTTGGAAGTTATATCTGTAAAAATCTAATTTGTAATAAAATAGATTTTACGACGATACAAATTCAA
CCTGAGGACAGCGCCGGAGCACTCGTCTGGACGGAAGCACACCAGTGTAGGGCCAGCGTCGGTGTTGATTCGTGCGCGTGTGTGCATCCTCCCCACGTGC
TTAGTCCACCTCATACTCACCCGCGTATTGTGCCGTGTTCATCAGTGCCAAGATGAGCGTCGTCGCCGCCTCGCAGCCGCAAAAGACCTACTCGCTGGCG
GACAAGAAGCCCTACTTCAAGCACTTCTACCCCAGGGATGTGGCCATCCTGGCCGTGCGCTCCACGGCCATGCAGGGTCTGATGCTCTTCAACGCGTACG
TGGCGTCGCTGGACCTGGACGTGTCGGACGAGGAGGAGTCGAGCGAGGACGAGTTCGAAGACGTGGACGCCGCCGCCGAGGACAAGGAGGAGTTCGTGGC
CCCCTCCATGGAGGAGTTCAGCCTCGCCACCGTCAAGTCCTTCGGCAAGTCGCTGAGCATCACCACGTACGTGCGCTCGCTCGAGGAGGTGGCGCTGTGC
CTCTTCCGCCCGCAGATCGTCAGCAAACTTATCAAAGGTATGCGAGACGATACGCAACGTCGCTGAATATGCTAGCGAGGCATGCCTTTTGCTGATGTTG
TTGTCCGCTGTATCAATGTGCAGACATCAGCAAGTCGGCGATGCGCAAGTACTCGCGCACGTCGAGTCGCATCGCTGCGGCGGCCTTGATGGTCAAAACG
GGCATGCGTGCCAACGTGCTGAGCCACCTTGCTATTTTCCTGGTGGAGGAGGTGCGTTGCTATCCTTTGTCTTGTTGTTGCTGCTACTCTGTGGTGACAA
TGTTGATCTAACTTTTGAAGCACTTAAACTCACCGACAATGAATTGTGTGTCTTCGCCTTGAAACCCAACAGACGCAGCAGATCGTGGTCATTCTGTACC
GACGCTTCGTGTCAAGGAAAGGAGGCAAGAAGTCCAAGAACAATCTGCGCTCTATCGAGGAGGGCGTCCAGAGCAGCGGCAGCGACGAGGAGGAGGACAC
GCTATCGACGTTCGTCGCCGCCACGGGCCGCAACGCATCTCGCTCCGCTTTGGCCGTCATCACGGGCGGCGTTGGCGCGGCGGTGGGCACGATGGTGCGA
CCAGGTATCGGCACGATGATCGGAGGGACGTTGGGCGACACCCTCGGCTACGTGCTGTTTTAGACGCGAGGTTGGGCTTCGCGGGGACGAACGAAGCAGA
AGACCCACCGAATGCATAACTGCAACATCAATGCTATACCAAGACAGCCACAGGAACTCCGACCGCGGAACTGCTTGCACTCTTTGCCTACCGCCCTCAT
ATGGCTTACGGACGATCGGATACTTGCCGCATGGCGCGGCATCAACACACGGAAGCCATTTTTTCGCGGCAGAGTTACCGGTGCAGCTCGAAACATCCTT
GTTGTCCGCTGGTCCGAAATGAATTTGAAGGGACCGTTTTTTATACTTGACAAGCAAAGCGCGACCCACTTAAATCGAGACGGAGCCAACGGTTCCTTTC
GTGGAAGTTCCAATATGCATTTCGTCAGGTTCGTACCAGTATCCAGATTACCTGCTGCCGTCATTCGCGACGGCGTCACTGAAGTGGATATATGCCCTAG
TGCAGGGGGGCACTTGCGGAATAAAAGAATGCCAGCTCACAAAGCAAAGAGCGCGCGCGTCGTCGACGTGATCGAGGCGCTCTGAGTGTCTGCCCGCCGC
CCGCCCCGCAGCGTAGCGGCCTCCCCGCAGCACCAGCGCTCTCCCCGCGCCTCCCAGCACTACAGACGCGCTCTGCTCTCGCCTCACGTCACCTGATTAC
GCCGTCCAGCGCGACTTCAAAGCCCAGACGCAGCTCATGACCACGGCGTCGACAATGTACATGGAGACCGTGTCGCTGAACGACGACGCGCCCCCGTCGT
CGGCCTCGGCCCCCACCTCGACGGTGCTGGACGTGGACTCGCTGGAGTCGCAGTTCTCGCAGCCGGCGGCGCTCAAGGCCTCCAAGGACGCCGCGTCGTC
GCCCGAGATCGCGGTGCCCGTGTCCGACAGCGATAGCGACGAGGACGGCAACGGCCAGAACAAGGACGTGAACGTGCAGTCAACGGGGGCCATCAACGGC
CTGAGCTTCCAGAAGCACGCGGACGACGCCGTCGTGGTGGACGTGGACCTCGGACACAGCGACAGCAACGGCTTCAGCAGCCAGAATGGCAACCAGCAGC
AACACGCGCTGCCCCCGCTGCGCGTCATGACGCAGAAGCTGCCCGTGGAGGAGCGAGACTACGTGGACACGACGCTGTTCTCCCCCGAGGTCTCGAGGCA
TGCCATGGAGGTGGCCCATCGCCGTGCAAAAGCTATCGCCAACGAGGTCAAGGAGATGATCGAGTTGGAAGGCGAAGTAGCAGGCGCCGCCAAGACCAAG
ATGTCCCCGGCCGAAGCTGTGGGCATCATTGGCGGCGCCTTTGCGAGCTCGCTGCAACGCGCCAAGAAGTTGGTGAAGCCTGGAACCAAGGAATACGATC
TATTGTCTGGGACATCCCCGTCGGCAGGCATGTCAAAACTGGACGATCTTGATAGGGACGGAGACGGACTGCAGCTGTCGCCGGATGCAACGCAAAGCGA
CGGAAAGCACTTCCGTACGCCTAAATTGAGACCCGCGCTGAAGCGGATCTCGGCGTACTCGGCGGCAGCTGCGCTTGAACCTGAGAAGAAGACCTCGAGT
ACTCGGCAACAGAAGAAGAAAGGCATTCAGTGGCACGAAGACGTGCTGGACGCCGATGAGGAGTTCTACGAAGACGACAGCGAGGAGCAGGAGACACGCT
CGCTCATGAATGGAGACGGAGATGGCATCAACAACAGCAACGGAAGCCCTCGACCCCAGATCCTCAACTACAGCAGCAAGAATGACGGACAGCTCACGCC
TCGCAGCAAGAAGAAACGCAAAAAGCTGGTCAGGACCATGATGCGGCGACTCACGCCGCGCGAGAAGGAGGAGCTGTACCGACAACGACCAGATCTGATG
ATTGTGCCGAACTGGGCGCAGAAGTACCGCGAGGAGCTGGCGGGCGAGGACTCGACTCGCTGGAATGCCTGGCTGCTTGGACTTATCTCGGTGTTGGCTG
TGCTGCTGTTGGTGTTCGTTCTGCTCATCGTGCGGCAGCGCGCCGCCGCCGCGACTTAAATCAACCAAGTAGCCGGACCCCATTAGAGACGAGCGGCCAC
GCGGGACGTGGCCTGCTCCCAGTTTTTGCTGCTTTATGTTTGGCTTGTTTGATTGAACCTTATAGCTTGACGCGCAGAGAGAGCGAGCGAGGCGAGTGGA
GAACTGCGCTACCAGATCACAACTACGAACTCACATTCCATAAAATATTTACTGGGACGTCAGCGCGTTTTACTTTATCACCGTCGGTTTCTTCGGCTTC
TCTATCTCTTTGGGAATACTACTACTACGTAGTAGCATATCTTTTGGAGCAGTGTTCAGCAATGCAACCAACGCTCAAGCTAGCAAGAAACAAGCACGCA
TTTCGTGTATTTCTTGAGGGGTTTGAATTAAATCGTCGTCGCGTAGAGGACGCCAAATTGCAGAAAACGAAGAGCTGGGTTAAACGAGAGAGACAACGGG
CCCGAAGGCAGCCTCAAAGACAGCGAGAGCTCGCCAATCCTGGAGGTACTACAAGCCACGCTGCTATCTTTCCTCTCTTCCGTCCACGCCGCGTCCTTTC
CTTCAACCTACGCGCACGTCCCCGAGGCAGTCCGAGCGCGCCTAGTGGTGGCTGTGGTCGAACTTGCCGTTGACGCGCTTCCAGTAGTTGCTCTTCTCCT
TGTCCTCCTGGGTGGCGCCACGCGTGGGGAGGATGCCGCAGATCACCCACGCAGCACTGAAGGGGGTAGAAATAAATCCATGTTAAATAAGGGGGTCTCT
CTACAAAGTGGTGGAAGATTGCTATCAGTACGTACGCTCCGGCGATGAGGAAGGGCTGGAAGTAGGAGCGCTTGGACTCGTGCACCAGGAACTTGGTGTA
GGGCAGCTTGTGCCATCTCACGGCCTTCTTGGCAACGGCGGCAGTCATCGTGGGTCTGGGGGCTCTTGGGCTTCCTGTGGCGACGGCGATGGCTGTTGTG
GCGAAAGAGAGGCCCAGAACGCTCGGGGGAGAGCGGCGGGCCAATGGATACCCTCG