Description :
From Genome Similarity Track
Location :
scaffold_73:2628- 4469
Transcript NameFunction/comments
Pl_110426secreted RxLR effector peptide protein, putative
Pl_110427NA

Sequence
1841 bases(100 bases per row)
AGAGATGGACAATGATGGAGGACTGGATGAAGAAAGATGGATTTATCTCTAGGTCAAGCTCGATCACATAATGTTCCGAGCTTTTCCAGCTTGTCAACTA
CAATGTTTCGTAGTTACCATTTTGGCTTTCAGTATTTGGACATCAATACATCAATTCATCGATTTCTTGATTAATTTTGACGATATATTGACAAAGGATA
ACACGTCATGGCGAGATAAGCGCTTGTAAAAAAGTTGATTCTACTTCACGCGATCTCTACTTCTCCACACCGGCTTGCGCGTCACTAATTGATATAATCG
AGACCGCGCCAGCAGTTATACCCAAACCAAGCAGAACAATGAGAGCCCTTGCCCACTTCGGCGGCTTGTTCTTCACCGCATGTAGGATCTGCGAAGATTG
CGTCGAAGTTGTCGAAGTCGAGTGGCTCAGTGCATTCCTCGTCGCAACAACAGAGGGTACGGCCATTCTCTCTTCATTTTTCACTGTCTGGCTTCCCCTG
AGATGGCGAGCGATGTTGTTTGAGACTGTCCCGGAAGCAAGAGCGATCTTGCTTTTTAGTTCAGACATCTCGGCTCCAGTAGCGCTCACGCCTCTCGTGA
CGAAAGCTACCGCGAGCAGGACAAGAACAAAGGTGACACGCATTTTGGCTGTGTGTTGTGCGGTGAATTCTGGAGTAACCGGTTCTACAGACGGCAAAGT
GGTAGACACATCCTAGGGATTGTAGTCCTGGCTCGTCAAATCAAGCAGCCTAGCATCCGGTTATGTGCGCGGACCAATCTAACCCTGGACTTGATCAACG
GACCTACGAGTCTTTCGAGGGGTGCCACCTGTGAAACCCGTAGTATTGAAAAATCAGAATGGTACAGCGAGGACGGGACCTGAACGAGTCATGCTAAATG
AGCTCCAGACTTTTTCGTAGTGAAGACCTAAGCAACTCAATAGATAACAGTCTGCCTCTCTTTATCTTAAGGATTGTGGGGCCGAGTGGCTCATACAAAC
AACGTCGCGACAGCAAAACTAGAAATCGTTACATCGCCGCCTTCTATTTGAGTTTGGATGCTACCCTCCTCTAGAAGCCTTATATAAAGTAGATGTAATT
CGTCTTTCGTTGCTGGCTAATTGCCTGCGGTGATGATTCTGCAACGTGTTTGTCGAGTCTTGGTGCTCAGCAGAGGTCGCAAACAGTTGACCGTAACAGA
TTATTGCCCGTGACCACGGGCAACTGTGGGCAACCGAATTGGTTTGCTTAAAGTAAACGGTCGGTTACGGGCGTCCGAACTGTATCTGGCTGTGTTCACA
TATCTTCGTTTAGACGAAACTCAAGTAGATCTAAAATAAGACAACATAATCTTGATTCCACTCCCATCCGACTAACAGCTTATACCAGTTACAGCGATTT
CTTTCCCTCAGACTTATAGACCGTCAAAGAAGCGATTAAACGGGGGTTAATGGTCAACGGAGAACAGTCAATATTAACCCTGTTCGCCGACTCCTCTTCA
GTAAGATCAAAATACTGGGATTCTTTACGAGTTTACCGAGCACATGGAACTAACTTGTTACTATGGCTTAGTCGTACTGAACCACACGAGTTTGATTTAT
TGCAGTGGTGGAAAGGTGCTTCTCATATTGTTATATAAGCCCAACACATTTAATAATATATAAGCTATCAATGCGGCACAGTGACTTTTATTTCACGGTC
AACCGATTATTTTTTTCGGTCGGTCACGGGAATCCGCTCTGGGAGTACGGTCAGTCACGGGCGTCCGAACAATCTAGGCTAGTACACACGGGCGTCCGAA
AATTGAAGATTGGGATCTCTGGTGCTCAGCTGAGTTGATCC