Description :
From Genome Similarity Track
Location :
Scaffold_177:26279- 28562
Transcript NameFunction/comments
Phyag_g3116hypothetical protein

Sequence
2283 bases(100 bases per row)
GGGTCTGGGACGTCAACGCGTAGTGCTAACCCGGGTGCTTCGATGtgatgtacatgtagcactGGTGATTCGCTTTCACCGTTTCCGGATACTGCTTGCA
TAATTTGATCTCGGCGATGTTGACTTGAGTTTGACGCACTTCGAGATCTTCGGCGTGGGAAAGCAGCGATGGCCGCTGTAGGTACAATCACCGAAGCCTT
CCCGTCCGCAGCCGACTTGGATATTTCCATGCCGTTCATCATACCGAAGCTAACAATGACTCCGCCGTTCCGGGAAAATGTGTTAGGTGAAGCCGCCTGA
TGCAGCGTTGTTTCTCGCCTCGGAGACACAACAGGTTTCATCTCTGTGGCATGTTTTTGCGAGTCCAACGGAGGAGGCCCGTCGGGACCTGAGTTAAGTA
CGGAGATATCTGCTGTAAGGTTGAGTGCATTGGCGTTGGTTTTCACAGAAAACTTGCGTTTCGGGGAGTCCTGTCCAAGTGTGCCACTGCCGGTTCGACT
TCGTCGGCGTTGTGATGTCGAGTTGGAGTCTAAGGGACAATCAACATGACCTCATGAGAACCACACGAACGACAACAAAGCTGTAACATTTTGAACCGCA
CCTTTTGTGGTATCTGTTCGGGGAGTCCGGGAACTTTCTCTTTCTCCACTTCTTGATGATGAGCGCTTGCGCTCACGCGAATGTGATCTTACTGGCGTTT
GGTTGACTTCTTGGCTCCGAGATTGTCGTCGATGTTCTGACGTACGACAGGCCACGGCAACTCGGTCAATACCTTGATTACCCTCAGTAGCAAGCTTGAT
CTGGCCTTGATAAAATGCAAACGTATCGCTAGTTATCTCTCGCTGCAGATTCTGGTCGATCTCTTCTATCGTCACTCTTTTCGATTCTTCTAATATATCT
ACAGCAAAGATGTCTACACACGAGTCGTTAAGACACATAGTTAGCAATAGGCTTCGTAAGCTAATTCGCAAGCGTGCAACCAACCTTCAAGGCGATTCAG
CTTGTGCTGATCGTTCAAAAAGTACGTAAGACAATGGGTAATACAATACAACAGCGATATGTACTGCCACAGCAAGAAAATATTAGCGTGAGATCACTAC
GGTCATAAAGCACTAAGCCGACGTACATCTTCAGGCTCAACCGTGTCAGTCCACAAATCTACAGATCACTCGAAATTACCAAAATCAGCACAACATTTCT
TGAAAGACGGACTGTCTGTACGTACCGACCAGCTCGAACATTGACAAATGGAAGAAAGGATAATCCAACTGGTCTTGCTCACCACTGTCTCGCTTCCAGT
CATCCAGAATCAATTTCTTGGAAGCGTCAATATCGAACTCGGGAAGAATCAAGCAGTGCAAGCACAGCATGTACGCCTCATAGTCAGCAAAGTTCATTTT
CTTCTCTCCATTGCCCAGTGCGCAATTCCAGAGCCGCTGCGTGAGTGCGATCATATGAGGATGCTGCTGTAAGCTCACGCGTTTCGCTAAATTGTCCTGC
ATTAAATGTTACTTGGTTATCTATGACATGATACCAGAGCGATGATTTACATCCGTACCTCAGTATAGTGATCCAAATTGCCCTGCTGGCGGTAAGTTAC
CTCCGTGCCAGATTTTGGGTCGACCTCCGCAACAACATGCCTGCGAGGATCATGTAACTTTACAGTTAGATTACTCCAAAGTCACACGTGCCAAAGGTAT
TCGCACCCTTCCGCTACGAGCTTGTGCACCTGCGTTTGGACGGTTGAAGCAGTAGCTCCCGATATTCGAGGCATATGTAGCGCGGCGCTATGTGACGAAA
ATTCAAAGCGCCATCAGATTAGTAAGAAACAAATTGAACACTTTTACCTTCGTTCTCCATTGCTCAGGTTTGACGCGGCTTTGGAAGTGCTCAATACAAA
GAATGGAGATCGCTTCAGATTGATAATCGCTCGAACGGTGCCTTTGAACGTCCGCAACTTTCGGTAATGAGATTTAAGCGATCCAAGCATCGATCCCCCT
TgagatgatgatgaaacGATTGAGACAGTTGGGACACCAGAGTTCATCACTGCCTGTAGAGTTTCTGATTGTTGTAAACGCTGTGGAAGTTGAGCCTGGT
CGGGTGGCGTTCGCTGCACAGTTTGTCCCGGTCCTTGCAGCTCAACTTTGCTCGCTGCTTGAACAGGAAAGCTGCCCGACATGATGCTCAGTCTCCGATT
GCCTTCCGATATCCTCCGGACGGATTCTCGCTCTTCTGCAGGTTGGTTCCAAGGCTCTCGGGTCATGGCTCAGCCTGCACTAC