Description :
From Genome Similarity Track
Location :
contig_22:262786- 266729
Transcript NameFunction/comments
g4751.t1Poly polymerase 2
g4752.t1hypothetical protein PPTG_09033

Sequence
3943 bases(100 bases per row)
GCTGCCGGTGCTGTCGCCGCCGCTCAAGAAGCGCGTGACGTCGCGCCGCGTCGCCAAAGCCGTCATGCTGCAGCTGCCGGACATCGACGAGGAAGAAGAC
GCCGAGAATGATGGTGGCAAGACCAACTGTTGCGAGCACGGCAGCGAGACGGAGACGGAGGACGACGAAGAGAAGCTGCAGCTCATCCGACCCGACCCGT
ACCTGCCAGAGGCCTATCAGCGCCGAGCGACCGTGTTGAAGCACGGAGGGAGCTTCTACGACGCCATGCTTACGAGAGTGAGGACGATACGGTAGAGGTA
GAGGTTGAATTGAATAAGAGACTTATAGTTGTGCGTTGTTGACTGTAGGCGCGCGTCCACAACAACCACAGCGAGTTCATTGCGGTACAGGCGCTGGAAT
TCGACAAGCAGTTCTACATCTGGACCCGCGCGGGGCGCGTCGGATGCGCCGGCAAGACGACGCTCACGGGCCCGTTCCCGAGCCTGGAGAAGGTCACGCT
CGAGTTCTGCACGTTGTTTGCGTCCAATACCAATTGCGAATGGGAGGAACGCCATGCGCTGCGATACCAGGAAGGCAGCTACACGTGGATTGAGCTAGAT
TATTCGACTGGAACGCCGTACTCGGAGTCGCTTACGAGCGCGTTGGCAGACAATCAGGGCGAGATGGACAACGCAGACAGCTTCAGAGACTTCGACCTGG
TGCCCACGTCGCCGCCGCCACTGCCGTCGTTGACTTCGTCCTCCAGTCGCAAACGTCGCCGAGCTGCCATGTGGACGACATACTCCTCCGCTACTGCAAC
TACCACTACAACGCCGCCGACAAGCGTACGGCGAGGATTGAGCAACCAATTTGACTGGTTGTATGCGAACTCGGATGGCGACACCGCCAGCGGAACTTCT
TCCGAGACGGCTACGTGTGCATGTGCCACCACGCCTCCGTCACGTTTACCAACCGAGGTGCAAGACTTCCTGACTCTCGTTGCTGATCATACCGAGCTGT
CGTACGCCTACACAGTCACTGACGACTTGCTGGGTGACGCCATCATGAAGCTGCCACTTGGACGGCTGTCCAAGACAACCATCAAGCGGGTACGTAGATA
CTGATCCCATGCTTGGCTGCGTTCAACAACGGCGCGGACTTAAGTTGTTCTGACCCCTTTGCTGTGTTTTATAGGGGTACGAGACGTTGGAGGAAATCTA
CGAAGCTCTGCGCAGCCGGCAGGTATCTCGAGCGCGGTTGACGAACCTGAGCAGCCATTTCTACTCGCTTATTCCGCATCACTCGCGTTTGGAAGTTATT
GATACAATGGTGAAACTAGGCAAGAAGGTTCAGCTGATGGCCGAAGTTGGTGCTAGTGTGCGCGGAATGGCTCATGAGCCGGTGGCACGGCAGTGTGCGT
CGAGAAATTATCTGGATGAGTGTTACGATTTGTTAGAGTGCGAGCTACAGCCTGTGAAGAGCTCGGATCCCGATTTTGCGCTAATTCAGACGTACATCCG
CAACTCGAACTGCTGCGGGCGGAAGCAGGACCGGCTGCAGTTGCTGTCCGTCTTCCGTGTCGAGAAGCCCGAGCAGGAGACGCGCTTCGAGTCTTTCCGC
AAATTTACCAACCGACGGGTAAGGCGTTGGGAGTTGCTGTGCTGTTTTGCTTTGCTGTTTTGTGTGTTTGTGTATGGACCCAGTGGCGCTAATAGCTACT
GTGCGGTTTGCTCCGTTGCCATAGATTCTGTGGCACGGCAGCCACTTGGCAAATTGGTTGGGCATCTTGTCGGAGGGGCTGCGAATTGCGCCGCCCGAGG
TGGCGTCGAATGGGCGAACGTTTGGCAAGGGACTTTACTTCACAGACAAGGTGACGAAAGCGCAGGCGTATTGCCACTGCCGACCTACGAACGGCCACAA
CCAGTGCGTATTCGCTCTGAGTGAAGTAGCTTTGGGCGAGAGCAAGGAGATGTTGAACTCGGACGACAACGCGAAGCAATTCGTACACTCGGGGCGGGTG
GACGCGCCAAGGGGGCCTATTACCACAGTTGCAAGGGCGTTGGGTCGTGCCGACCCGATTCGGCTGGGGAAGTTGTGGACATTCACGGTGCCATTTGGCC
CGTAGGCAAACCAGTACAGCCCGAAGAGCGGACGGGGCTGCACCACAGCGAGTATATCATCTACAACTCGAGCCAAACACGGATGCGCTACGTCGTTCTG
GCCAGGAGCCCTTACTAACAGCAAGCAAACACCACCCAACGAACGATTGGAGCGTACGGATGCGTGTGCTTAGAAGCTCGGCCGTCGCCTTCTCCTGTGC
GTCGGGCACGCAGACAAGGACATTTTGAGCTGCTGTCAGAGAGCACGGCGCCGCTGTGTAGTGCTGTTGCGTTGAAGTAAATACATGATTGTGCGTGTGC
AAAGCTGAGGGTACCAAGCAAGAAGAAGGAAGAGTTCCAAGTATCGTGTTGCTTGCCACCATTATAGCAGGGGGGGGGCATCACTAGACAGGCGACTGCA
ACAGCTTCTCGTCGTTCTTACTGCGACTTCTTGGCACGGGCAGTGATTGCATTCAGACGCTCAACGAGCGGCGGGTGGCTGTAGTGGTAGGCGCTGTACA
GCACATCCGGGTTCATGTTGGACAGGTTCTCGATCGCGAGCTTGGTGAGGCCTGACTTGAGAGCAGCATCGTGCCCAAGATCCACCGCGAACGCGTCAGC
CTGGAACTCGTTCTTGCGCGTGTTCAGGGTGATCAGGAAGGACAGCACGTGCTCCACCGGCGCCCACATGGTCTGCGAAAAGAGCAGGAAACCGATGATC
ACAGGCTTGGACGAATCACCAGCGAATCCAAAGCTCGCGAAGAGCTCGGCATCGTTCATGCAGAGACCAAACACGTAGAATGATGCCAGGATGTACGCCT
GCTGGATCACAAAGCCCTGCGCCGTGTGCCACAACTTCCAGTGTCCAAGCTCGTGGCCCAGGATGGCGACAATCTCGTCGTGCGTGGCCTGCTCCAGCAG
CGTATCAAACAGCACAATGCGCTTGCTCTTGAAAAAGCCGAAGAAGTAAGCGTTACTGTGGCTGGAGCGCTTGGAGCCGTCCGTGACGAAGAGCTTGGTC
AACGGGAAGTTAAGACTCGCAGCCAGCGCCTCGATGCGCGTGCGGAGCTCGCCCTCCTCCAGCGGCGTGAACTTGTTGAACAGCGGCATGATGAGCACCG
GGTAAGCGTCATCATGACGACAGAGAAGGCAAACAGGAAGGCCCAGACGTACATGTAGAAGTACTCTCCTCCCCATCGGATGACATAGATCAGGGCCGCC
GTCACGGGGAATCCAATCGCGATAAACAGCGCGAAGCTCTTGATCTTATCCATGAAGAACAAGCCTAGCGTCTGCTTATTGAACCCATGACGAGCTTCCA
CCACGAACGTCGAGTAGAGTCCGAAGGGGATGCCGACGAGCGTGTCTCGCACCGTCGTGAGGGTCAGCAGCATCAAAGCTCTGTAGATCTCATTATCGGC
GTCCAGTCCCACAACCACGAGCGCTTTGGCGCTCATCGTCCACATAAAAGGCAGGTAGCCCAGCAGCAACAAGGCCGTGCCTTCGAGCTGGTTGTAGGCT
CCGCTCACGAAGCCGAACGTGCTCTTGTCCAGTCCATAGGCGCGGCTCTTGTCGAACTTGGCCTGGGTCGCCGCCAGCAGCGTCGTCTCCGTCTTATCGT
CTGATTTCTGTTCTGATTCCTCCTCTTTCTTCGTCTTGACGCTGTAGCTGCCGAGGCCCTCAATCGCCTCCTCCAGCGGCTTGGGGAACCGCTTGTCGTG
CAGTTTGCGGTGCTGGCGGACGTCCAGATACGTCTCGAACAGGAAGACAACCGTCATGAACACCAGCGCGCCCAGGAAGTACGGCACGGGGCTGGCACTG
GGCCTCCAGCCAGCCTCCGTGAAGTACGGAGCCTGCCACCACG