Description :
From Genome Similarity Track
Location :
Scaffold_201:26276- 28726
Transcript NameFunction/comments
g11128.t1hypothetical protein

Sequence
2450 bases(100 bases per row)
ACCAGCGTTGGAACATCACGCTTGATCGAATGGGCAGGTTCCCAAGAGTTCTCGATGTCCTGCAGGCCGCGCCAAGCCACCAGGAGCTCCAGCTCACCAG
ACGTAGCATTGAAACGGTGTGAAACTACATCCCGAACTTCGAGTATAATGCCTTGCAAAGACACATGCTCACGGATCTCGGCCGTCTCGTCGAGGTCAGC
ATCGTGGTAGAACTTCAAGCGCGAGCCATGCACATCATACTCAGCCCCAGTGAGTAAATGGCGGATGAGGAACGAGTGCGGGAGGGCCTTGGTGACCTGG
AAAGGTCCGACCCAGCGCACAAGCAGTTTGTTCCCCTGCAGTCGCTTGTCCACTCGCGACCAGAGGACGTAGTCCCCTTCAGAAAAATTGCACACAGTGC
CGTTAGAGCGTGCCATCGCGGCCACACGCTGCTGCTCGCGGCGGTCACGGACAACACGGTGCAGTCCGTGCAGGCTACGTCGGAGCTCTTCAACCGCCTC
GCGTAGCGCAGCCTTCTCCATGGGTAGATTTCGCAGCACTCGCTCCGTAGGTGTAGCCACAATGTCGAGAGCGGAAACAGCAGGTAGCCCAGTGAAAAGC
TCCACAGGGGCACAGTTGCCCAGTGAGTACACCGGAGTGTGGTTCAGGTTTGCCTGTATAATGGGCAGGAGATACACCCAGTTGCGGGTATCCAGGCGAC
TCTCCAACAGCATGACACGCAGCACCTGAAGGATGTCACGGTTGACCCGTTCAACGGTGCCGTTAATCCAAGGTGTGTACACTGGCGCGAACTGGTGGCT
CGCACCGAGCCTCTCCGCAAGCAGCCCCACAACTTCGCTCTTAAAGTGCGAACCATTGTCGGACATCCATGTTGGAGGGGCCCCGAACCTCTTGTTCCAG
TCAAGGATGGCTGCCACAGCAGTTTGGCTGTCTGCTACGTCTGCCGGCACAAGCTCACAGAAGTGGGTGAGCTCGTCCTTGAGGACCAACACGTACTTGG
TGTCGCCATAGCTCTCTCCAAGGTAGAGGTAGTCCAGGTGCAGACATTCGTTGCGCTTTGCTACTGGTCGGTCCACCGTCCAGTTCCTTTGAATCACCAG
GCCACCCTTGACATGTTTGCACAAGAGACACTGGTTGACAAACCGAATCACCGCTTGGCGAGCGTTCGCTAAGACGAACCTGCGATCCAAAAGCTCCACC
ATCACATTCACACCTCGGTGCCCTTGGGGGCCACAATGCGCCACCACAAACAGACGCTTCAACACCGCCTTTGCTTGTGCAGGCAGCCACAGCTTGTCAT
CCACTTCAATCCCGTCACTAGTCATCACGGCGCTGTCGGGTGCATCTCCCTCATACTGATGCTGTGCTCGAACAATCTCAGAGCGCGTCGGCCACGTGAA
CTCGTCGTCCTGTAGTGGACGCAGCTCAGACAGTGCCTGAGCCGACCGTGTAGTCACTCGCTTAACGGCCAGAGACTTGACTGTATCAGGAGGCGCAGGC
TGCCCCCAGCGTGATATGATATCCGCCCAAAGGTTGTTCTCGCCGGCGATATGATGGATGACATAGCGACAGCCCACTAGCTTCAGCGCCCAGCGTTGCA
GTTTCCCCTTCACGTGCTGCTTCACCTCTCTGTCAGGTGTGAAGATCTGAATAAGGTTTGAATGGTCGCAGTACACGTGGAACCCTTTCTCACGCGTGAG
CATGTAGTCCAGGTCCCCACACGCCTTCACGATCGGATACCCTTCCTTCTCGACGATCGACCAGTTCCTCTGCGCATTCTTGAACAGTCCGCCTCGGCAG
ATCAGCAGTTCATGCTGCTGCTCTTCAACCGGGACTCCATCCTGCCAATTCAAGACCTGGGTCAACACCAGTGCATACCCAGTCAGCGAGGCGTCCGAGA
ACAAGCACACCGTCGCCCTTTTATCCGGGAACGCCAGCTTGCATGATCGCTCGATCATCTCGAGTGTTTTCCGAAATGTTTCCGCCTCTTCCTTACTCCA
TTCCACCACAGCTCCACTTAGCTGAGCTTTACGACGCCCACGAGACTGCATCACGCGCTCGAGTTTTTCCTGCAGCGGCGCAGTTGTGCGTGCATAATCG
ACCATCGAGTCTCTCAGCCAATTCAGTGCGCACAGGAAATGCTGGAGCGCAGCACCGGTCGGTGGCAATGGCATCTGCCGCAGTGCGGCTAATCGTTCAG
GGTCGTGCTCGACACCAGCTCCATCGATCACCTTGCCACACCATTTAACACGCTTCGCAAAAAGTTTGCACTTGCGAGCGTTCAACTTCAACTTTCGCTG
CCGTAGAATGGCGAAGAACTTGCCAAGACTCTCCAGAAAAGCTCCAGCAGTGCATGCGTACAGCAACACGTCGTCAATCCAGACAAGCACGTTCCGAAAT
AATAGGTCCCTCAGTACTTCGTGCATTTGGGCTTGAAAGTGCACTGCAGA