Description :
From Genome Similarity Track
Location :
Scaffold_1106:2627- 4433
Transcript NameFunction/comments
g11781.t1hypothetical protein

Sequence
1806 bases(100 bases per row)
AGAGGAGGGGACATGACCCGCCAGGGCTCTTTTCGCGAGGGGCTTGTGACTAGCACCAATGGTGCGACTTCGCCAATCAATCCACGGCTCATGTTTAGCA
AGCCAAGGCATGCCGAGGATAAGATCGTACCGATCGTCCATGTCGAGGACAATGAACGGTTCGACCGAGTTGAAGTCGTCAAATTTGACGTTTAGGGATA
GAAGGACCTTCCGTGTAGACACGAGCAGATACGTTTGTATTTCACTTAGATGCTTCCAAAGCACTAGCATACAATGCATTGTTCCTAGCCACACTGTCCT
TCGTCGCGAAGTTGTAGGACGCTCCCGAATCAATCAGGACCTTCAATGGCTTGTCATATCCCTTAACGCTGGCTGTGACAACCACGAGGTTAGACCGCGC
GGCGGCCACGGAGAGACACAAAAGTGTCGTCCCTGGGACTTACTCCCCAGGAGGTGGAGGTGGCAGAGCTACCGACCTCGAGGAGGAGCGATGTCTCCCA
GCAGGGCGTCCCGCACCTACTGGGAGTCGCCGTTTTCCGACATCGCAGACTCGATCACATTGAGCAACGGTGCGGCCTTGCCGCGCCCCGTCTTCCACGG
ATTCGTCGGGCAGTTCCGACGGAAATGACCAAGCTGGTTACAGCCAAAGCAGCGACCACTCGCGCGTTGATTGCGCTGGGGACGAGCCGACTCGGCCGAC
GAGATCTCCATAGGAGTGGGATCTTCCGTCGCCTCTGTGCGACCCGCGTAGCCCTGCGCTGAGCGCACGCAATGATCTTCCAGCATGGCGATGTGCACGG
CATCGTTGAACGTCGTTGGCTGTCTGCGGAAGAGCTCAGTCCGAACCGGGCCCGGACGGACGCCATCCATGAAGACCGTCACCTTAACGTCCTCAGAGAG
GGGAGCACCTGCCATGGCAGCCTCGAGATTCTGCAGCTCCATGACGTAGTCTTGAAGCGTGCGCGTTCCTTGCTTGCACCGCAAAAAGAGTGACCGATAA
CGGTAGGCCACATTGGCCAGGAGGAAAGTCGAATGCAGTTCTTGTTCCATGAACGCCCACGAGGTGAATTACCCCGGAGACGAAGTCTCTCGTGCCATTG
CCCATGCGCGTGCACGCCCTCCCAGATTGGAAAGCGTGAAAGGAACTTGAGCTCTTGACTCGTAGATCTGCCCCGCGCTCAACGCTATCTCGATCTCACA
AATCCTGAAAACAGACTGTCTACTCCTTGCCGTCCGAACGTCGTACCGACTCTTGACGGGCTTCGTAGTTACTTGTCGCGCGGCGTATGAAGCAGGACCA
GAGGGGTTCGCCTGCGGCACACTCTGCGCCTCAGCTCCCATCGCCGTGCGAGCAGCTTCCTGTGCCGCAGTACTCACGTGAGCAATCAGCGACGACTCGT
ACGTGTCGAAGCGTTCCACGCGTGACCTCTGCTGGTCTGCAGGAAGGTTGGAGAATCCAGCAAACGCTGCTTCGCCCAGGAGACTGACCATCTTTTCCAG
TGTAGCCCAGTGGGCACCTGAAAGGTGAGGAAAGTCCTGCCGGGACGGCAGCCTGCTCTCTGATTCTTCCATACTCAGAGAGATCTTGATTGTAGCGATC
CGCGCCGGTCGCGGGAGTGACTACAAGTGCTACCAGGTGTGACGGGGGTCACACGCATCTTAGCCTTAGAGGAAGCGTTAACGCGCTAACCACAACAGAC
GCCTGGCGTCTCTGTTGTAAGCTTGCCTTCCAGTCGTTTCCGGGTACCGGGTACCAAACGACATGCGAACTTCCAGGTTAGAGTTAAACTGCCTGTATTA
ATCTCA