Description :
From Genome Similarity Track
Location :
Scaffold_109:2626- 7256
Transcript NameFunction/comments
Phyag_g2164hypothetical protein PHYSODRAFT_294930
Phyag_g2165conserved hypothetical protein
Phyag_g2166elicitin-like protein RAL7B
Phyag_g2167serine hydrolase (FSH1)-like protein, putative
Phyag_g2168conserved hypothetical protein

Sequence
4630 bases(100 bases per row)
ATTTTCGTGACGATCAAGGACGACAGTATGGATGGAGAGCTCCCAGGTTTCTGGAACACTTTCTTCTACATGAATTTCCAGCActttgcactgctgctgt
gggtcACTGCTATGGTCGTGTGTGTCGTGGTTAGTCTACTGACACAACACAAGAGCCGGCCGTCAGAGGAAATCCGCAAGTACATGATCCACTGGGACAA
GGTTCTTAAGCTCGATGCTACGGAGGTTGTCAAGCCCATGTGGGTTAacgttctcgtcgctggtagtggaattgctgctcttgctgtcACATTTTCTATG
TGGATCTACTTCGCGTAAATCGAATGCAGATGTAAGTTTGTGCGGTGGATTCAATGAAGCACAATGTAAAGAAACGCAAGTAACAACTCATTTCACTATG
TCAACAGTTTTTCTTCGAGTCTTCTCCACTTTCTCATTGCTCTCACTCGATCGCAGCAACGGAGGATAAATCACTCCCTTTCTGAACAACGATATACCCG
TCATGCTCGATGCTTGCTACAAACCCAGAGGTACCATCGGATAGATTCGTGCTCTCTCTCAGTCGAATTTCAGCACTAAACGCCTTGTCTGAGGCACTCA
CTTCAACTAGATTCGTACACTGGATGGCTTCGCGAGAAGTGAAATACGGTAGCAGCATCTCCAAACTCGTCGTATACATCCCTGTTGCGTTGTGGTGTGC
GTGTTGCGCGTAGTAGAATTGGAAGCTCACATACCGCAGTCCCCATTCAGGATCGAGCGGCACAACGTTTCCATCCCTCAACTCGGGTGGGGCTTCACCT
TGCAGACGAAACTGGAGATATCCCCACCACTCTGGGCGATGCATATCCACCGCATCTTGAGCGCTCCACACCCAATTCTCCTCGCTCGATCCAGCTTTCT
TTTCGTAGTACTGTTCTCCTGTCTGCCCGTGAGTGATGACTCGCACAGGCCACTCAACTCGTGAAAAATTGATCCGCCAGAACGAATtcgacgctggagg
aactggcgACTTCGTATGCGCTGCAAGTTCCGACAACGGCAGTGCGATCTCAGCAGTCCAGTAGTGCAGACGCTCGGCTGAAAATTCACAACCACCAATA
TGATCAGCTACGTCGTCAACATGAGTTCGACCGACATACCAACTTACACGGATCATTAATATTCCCTTGGACGAACACCGCAGAGCGCATACCGCTGTCC
AACATGTCGAAACCATGTCGAGGGTCCACCCGGGTACTGTTCTCATGACCACCGTCTCTATACGGACGATTTAGCCACAGGTTCCAAGTGGCATTACGAG
CGTTGATCTCGAACTCTTTGTAGTTGTGTGTACTCCCGTCCGTATCTACAAACACCTCGAAGTCGTTGTCGTGGAAAACAACGTCGTTGCGCTTGGTCAC
ATTGGCCCAcacctccgtctcctccaagTAAGCCCCGATATAAAGGAATTGCTGGTCGTAGCGCAGCTTGACTTTGGTGGTGAACCACGGCTGCGACCAG
AACGTCGGGCCGCGAATGTCTTGGAACGGCTCGCTCCAAGGCACTTCGGCCCACACCTCTTCGTCCAGAACTccgtcgatggagatgctTGGCGAAAACT
GATCCGTTGGCGTTGGAAGGTGATAGGCGGCATATCGACGAGGGTGCAGGTGCGTGAAGTCACATGGAGACGTCGATGCAGGAGCATcagaagttgctgg
aaactgttgaagttgatgcacttcaacgacatTCGATGAAGTCGAGCGTGGCAGGACTACGGACAGCAGGACGATCAGCTCGATGGGGTGCATCACGGCA
AACTTGCTAGATTTACAACTGAGATCGCAATTAGGACGAGCCAGTTGTCTACACAATCGCTACACaattcaacttcaacttggagaAGATGTGCTTGTAG
CAACTATCGCTGACGGGGTGTCAGTGCACTGCAACGTGAACAGTATTTCCCGCACGGCAGGCCAACACCGGCATCGACGTGACAGCGTGTGAGACGCTGA
GTTACTCGCGATGAATGGCACACGCATCAGGATTGACAGACCTGATCATGGGGCTGCTTGCAAACAAGACGTTTGCACCGTGGAATCGTTGTGAGAAGAC
CAGTCTGGGGAACCTCGTGGGCGCAGAGGTAGTGGTGGAACAACCAGGGTCACCAGGATGCCAGTTATGTAAGCCCTGCACAGCTTTGCTGACGAGAACG
TTTATGATCCCACTGAGACTGGGATCATCCCAGTCTCCCTGTTTTCAGGCAATAGTGGCTATCTCCAAGCCAGTTAGCTCTTCAAATTGTAGATTCCAAC
AGCGGAAGCACAGATCTATGGTCTCTTCGATCCGAAGTTCGGATGGTCTCAAGAGTTCGGGATCAGACGATAACGGTTTACTCTGCATGGTCAGCAAGCC
CACCCGAGCTTTACGTCGTGCAACAGTAGTCACCAGAGCAGCCATAGAATCCATAATAGATCTCTTTGGTCGGACCTCGGATGCGAGTCACAAGCAACGC
TCTCTGAACAATTCAGTGAACGCCATCCTTGTTGAAGCGGGCACATCAAAGTGCCACGAATGATGCAGAGGCTCACTGCCAGCGGGTGTCTTCCGCTCAG
GCCACATCTTTCCCGCTGCTGGAACTCCCAACGTCGGCAATGTTTGCTGTTTGACGAGAGCTTTGCACGGCGGCGGTCACCACCTCCGCCCTTGCGGCCT
CCGATTTTCAAGTCACTGGCCGAGAGCTCATTATCCAATCTTCCTCCAAGCTCCAACACCAGCTTTCCCTCCTCCCTCCTCTTCCAAGACCATGAAGACC
TTCACCtacgccgccgccgctgctgtcgcctgCCTCGCCACACAGAGCACTGCCTACTCGACCGCCACGTGCCCCTCTTCGGAGACCGCCAAGCTTCTAG
CGCTCGCCTCGGACTCGTACCTGGATTCGTGCCAAACTGCATCGGGCTACACGTTCGTCCCGCCGTCGGCGTACCCGACCGTGTCCCAAGTGCTGCTCAT
GTGCCTGACGTCGGAGTGCCGCTCGCTCATCACTGACCTCCTGGCGCTCAACCCCGCGGACTGTGTGATCAACTTCGGAACCGTGTCCATCAACGTGCTC
GAACTGGCGGAGAGCTTCCAGCCCAACTGCACGGACCTCGGTGTTTGGGCCTAAGTGGTTAACGCGCTACGCAAGCACTACGAGGAGCAATAGTGACGTG
ACAATTCGCTCGTAGTTATTGAACTCATGAATGAAGTTCCATTTTGACGTGAATTCCTTGTCATTTTTCATTGTATCTCTCGTTTTGActgatcttcttc
actacCTCCGTTGTGCCAAACAAAAGTTCACGACATTTATGCGTATCCAATCTACAGCACTAACAAGAATTGAGCACAATACAGCAGCAATGGGGTTAAA
CACTACGGACATTCGCTTACAAACTCATTCTTTTTTGAACAATTGCTTAACTCTGGAGAGCATTCCCAGTTACGGTTTACTCGACTAGAGCCTCGACAAG
TTATCGTCGGCTCCCTTACGACAGTGTTGCTTGATGACAAGCCCCAACTCCGCATAGAATTCACGGTTTTTCGACACGGACGGGAACTTGTGACCTCCAT
CGTGCTCGTAGATCCACTTCTTGAAGCCGTTGGGCTCCGCCTCGTCCGCCCACGACAAAGCCAATCGATGGGATTCGTGATAAAGTGGATCTGTCTTGCC
AATGAGGTGAATGGACGGCAGCGGAACACGAATGCGGCCGCCTTgctcgtccaggaacagcgACTTCACGTTGACCCCACTCACGTCCACACCACCGACG
CAGATCACGAGTTTCCACCAACGCACGTTCCCGTGACGCAGGTACCACATCGTCAAGATCGTCAGCAGTGCTGCACCTTGCGAGAAACCAATAACCACGT
CGAACGGACCGTGACGACGAATCTCCTCGTCGATCCTCACCATCGACCGCTCGACGCCCTTGTAGGACAAACTCCACGCGtggtcttctccttggtcaGC
GCCGCTTTGTAGTCGCGCCTTGGCCGACGACTCGGCGTCATTGTAGAGGAGTGGGGATCCGTCAGCCAATTGGTTCTCAAACCATTCGTAGAATGGGGCA
CTGGACTTGTACGCGCTCTCGATCATCGGGTCACTCGTTCCACGAGCTTCGTACGTGCCGTTTAGCATCATGAATTCAGCTGACGTCCCCAACGCCGCTC
GAATTCCACGCGTCTGGTCCAGCATCACCTGCTTGTTAGTTCGAAAACCATGCAAACATAACACGCGGATCTTCTTGGAGGAGTCAAATGGACGCGATGT
AAGTGCCGTGGGGTGAGGCAGATTCTCGGGGACAAGCACCATCGCGACAAGTCGATGAGTCTTGCTAGAAGCGCTGCAAAATGTCGACTGAGCAGAGACA
aagaccaacttcaacaagggTGACGTGCACAAATTGGCCACGACCCTAACGTCACGTCTTGACGGGCGCTGagaaagctgaagcagcacaggTTGTTTAA
CAACGTACGTCGACTGTATTTTAGTGGTATGCTGTCGTTCTCTATCAGCTTTACTCCTCATAGTCTCGCCACCGAGCTCTGTTCCGTATCTTCGAAGAAT
TTCCAGATTGTGGTGGCCAAGTCCGCGTAG