Description :
From Genome Similarity Track
Location :
contig_36:262536- 263640
Transcript NameFunction/comments
g9190.t1RAW25672.1 Glucose-6-phosphate 1-dehydrogenase [Phytophthora cactorum

Sequence
1104 bases(100 bases per row)
GGTAGTGCAGAGCTTTAGGTTAGACATGAGAACAGCGCGGGCAGACCTTCCCAATGTCTGGACTGGGCAACAGCTCTCACTTTTGATTTTGATCAATACA
CGACGGCAAGAAAGAGGCCAGCTCCCCTCGCTAGTGCTTTACACTTTCCTACCAACCGACAATCAACGAACATGCGGCTGAGCACTCGAGCAGATCTTCA
TATCTTTCACGTAGCTAGCCCCTCTGAAATCGATTGGGTGACTCCCTATTCTTATTGAGAGGTACAACTACGTAATCTTTTCCCATTCGACGCCCAATAG
TCAATCTTTAGTCGAGTTTTGACCAATGATCGGTCTCTGAGAAAAAAATTGGCGCGTCAACCTCCGCTTCTTGTCATCAGATTATATGGTCCGACAGATA
GCGTTCTGGATACGCTGCTCCGAGGCACGCGTCGAAGAATCCCCCTTTGGGCACGAGCCTCTGCTGAACCGAACGCGGTGATATGCCTGGGGAGGCCCAG
CAGCGATTCGCCAGTTGCGTTTCTAAAGGTCGGAGATTTCGTAAATGGCACGTTGAACCTGGATTTGACAGTCGTCAGCCAATCACGTCCGTCCAAACAT
TGTGTGTGCGTGGCGTGGCGCGTAATCCACCATCTAACCTTCCGTGAAATAGTCTAATTCTCTCCATTTTAGTCTAATTCGTGCCTCCTCGGTGGTCATG
TGTTGATGCAAACGCCGAGGGATGACGTCGGCCACTGCTGCTTGGGGCCGGCCAGTCTCGTACTTTCGGCAATGCTCTCACAGCTCAAACGCCGATTTAC
CCGCAGCAAGATCCACGGCGAAGAACAAGACGACGGAAGAGTGACCATGAGCCTCTCGAACAGCAACAGCACCAGCTCCCTGCCCCCCGTGGACGAGCAC
AACGCGTGCGAGTACCTCGACACGGCGCTCACGATCTTCGTGATCGGCGCGTCGGGCGACCTGGCCAAGAAGAAGACGTACCCATCGCTCTTCGCGCTCT
ACGTGTCGGGCTACCTGCCGGAGCACGTGGTCATCATGGGCTACGCGCGCAGCCACAAGGAAGAGGACGCATTCCGCGCGCAGCTGGCGCCCTGGATCAA
GCCC