Description :
From Genome Similarity Track
Location :
Scaffold_16:26247- 28524
Sequence
2277 bases(100 bases per row)
AGGCATCTGGTGTCCACTTGGAACCGTTGCCAGAGGTTGCAGAGATACTGCACCTCGAGGAAATGACGGCTGAGTCTTTCCTGACCAACCTCAAGGCTGG
AGAGATTGCTGAGATGGTACTCATGCGACCTGAGACCACTCAAGAGGAGCTGAACTCCTCCTCTGTCTTGGACGAGAACGTCCTGGAAGACATGAACAAG
CAGCGTCAGGCGCGCTTGGGTTCTGAGATTCTCAAGAACCCCAAGGATCCGGTGTATCCTTTGGTGACGGAGTACTCGGACGTGGTGAACAAACACCCAC
CGACCCAACTCCCACCGGATCGAGGCGTACGGCACGAGATTGATCTCGTGCCCGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTCCCGCGCGAACA
GTGGGAGGTCATTGATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAGTCGGAATCCCCGCACTCGACGCCGACTTTCAGCGTTCGTAAG
CCGAACGGAAAGTGGCGTCTGGTTCACGCTTATAACAAGCTGAACAACGCAACGGTGCCGGCCCAAACACCAATCCCACGAAAGGATGTGTTGTTGAACA
ACAAGACCGGGAGCGTACTGTACAGTGCGCTGGATTTGGTAGACGGATACTACCAAATCCTGATGCGAGAGAGCGGCTTCCCGCTCACCGCGGTGAGCAC
TCCAAGCGGCATGCTTTAGGAGTGGCTCGTCATACCGCAGGGCTTGTCTAACGACCCGGCGACGTTCAATCGCCTGGTGACGCAATTGTTCCGCCCTTTG
CGTACCTTCGTACAGACGTACTTCGACGACATATTCGTCCATAGCCGTGCCGAGGGAGGCAAGACGGCCATGGAGGTGCATCTAGGACACCTCCGTCGAG
TGCTGGACGTGATGCGAGCGAACAAGCTCTACGCCAACATCGACAAGTGCGTTTTCGCGTCACCAGAGATTAAAGTTCTCGGTTGCTTCGTAAGCAACGT
GAGCGTTCGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCCGACGCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGCTTGGCCAACTAC
CTTCACAAGTACAGCGCAGGGTACGCGGGCTTCGCTAAGCCCTTGTCGAGTCTCCTTCAGAAGGACGTCGACTGGCGCTGGGAGCAAGAGCACCAGGATG
CTTTTGACAGCATCAAGGCCAGTCTCCAAGAGGCCCCCTGTCCTGGCCTTGCCGGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGATTACG
CCATCGGATGTGCATTGCTGCAGCCCGACACGGCTGGACACGAACGAGTCATCTCGTTCCAGGATAGGCAGCTCACATCCGCCGAGCGGAACTACCCTGT
CCATGACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGCTCCGTGTTCACCTTCTGGGCTCTAGGCCCTTTGTGATCTACACAGACCACGCGTCC
TTGAGGACGGCGACTAACTCGCCTCACCTCTCCCAAAGGATGGCGAGGTGGCTGTCCTTCTTCGCGAAATACAACTTCCGCGTCGAATACAAGCCGGGCA
AGCTCAACGTGCTGGCGGACGCCCTCTCTCGGCGTCCCGACTATGAGTTGGCCCACATCACGCGGGTGACAACGGATCTATATGATCGGATACGCATGGC
GTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCTTAAGGCCTGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTC
CACCGATATGAGTTGAAGGAGGGCCTCCTCTATTATCGGGTGGAGCCCAGTGAACCTCCACGGGTGGTCGTACCCAACGACGAGGATCTGCAGTTTGATA
TCCTCGTGGAGGCGCACGACGCACCCTCCAGCGGCCACTTGGGCCGCGAGAAGACCTTTCTGTCGGTCTCTCAGGCCTTCTGGTGGACCCACATGTACAA
GTGGGTCGCCCGATACGTTAAGACATGTGAAACATGTCAGCGGGTCAAACCCGCAGGGCACTCTTCGGCTTCACTACAGAGCCTGCCCGTACCGGCTGAT
TGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACGGCAACACCTGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATGG
TACATCTTGCTCCAGTTCCCGTCACTGCTACGGGTGAACAAACCGCCAGGTTGTTCGTCGATGGCGTGTTCCGCTAT