Description :
From Genome Similarity Track
Location :
Scaffold_37:26241- 32887
Sequence
6646 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTGCTTTTTCATATTAGCTCGGTTTCTCGCTA
TTTGTGCCACTGTCTAACCGTTCTAGCTTCCATACAACGCTTGACCGTCCCATCCAGGGCACTCGCGTCAGCACGATCATGCGGAAATACTTCGTTTTAG
AGAACCTTGTCTAGTGGGTATCCTGAGGACGTCCAAAACGCCTTATCATTGAGGAGCGATATGAAAATGAACGAGAAGTTTTATGGTGGGGCTTGGCCTA
ACACTGTTCGAAAAATACTCGACTGTGGCTTCGGGATAACATGATTGAAGTGGAGGCCTGCAAGTTGGTGTTTCTCGGCAATGGTCGCAGGATAACGAAT
GAGGTTACAGCTTTGGGGATATGAATTTCTCAGCTACCAACACAGGTCCAACGCGAACACGTAAATCAATGCATCCCTAGCGGCGAAACCTCTCGACCTC
GATATCATTTCCTGCATTTCCTGCAAACTATCACTTTAGAGTCTAGGGTTTCGTGAAGGATTGACTACCGCTAGCTAACTTTCACCGCCATCGATTAACT
CAAACATCCTAATTAAAACCGCCGCTCGAATCATTCGCACTATTTAGGGTCACTTATTCAGCTCAGGTTACTTCTACGTGAACGACATCTTCTAGCGTTC
CACTAACGACGATGATACATTGGATATTGGAGCGGACCTTCGACTTAAACTCGTAGGTGATCGCTGGCCGACCCCTGATGCGGCCTCGCTATTCATGTTA
GTTGGTAAAGCTTAGCTTAGCTTAGCTGTAGGAACTGTACCTAGCGCTGTTGGGTTTGACGAGTCCCAAGAAAAGAAGACCTGCGCCAAAATATCAAATC
ATGCTGTATTGCAAGCGCATGCACTTATCGATATTATGGGGACCAGGGTGGTGGACCCGGGGGGTCTCGCAGTTATAAGCTAGCTTGTACGGATGCCCTT
ACAGGGAAACGATGTACTCGGGCATCTCCTGCGCGTGCTTCGCAGCCGCAGCATCTGCATTTACTACTGTACAACCAAGTGTACCAAGTTTGATTGCATC
TTTTCAAAGGCATTGCCAGTTCTCTCCAACGAATTGGTGCTTCAACTCTTGGGTTTGACAAACCCAACGTGGTGATTCTACCTTCTCCTGCTCGTTGGAG
TAGGACTCCACGGATTTAGTTTTAACTTTAGTTATTTTGTAGTTAGTAGAACGGTTATCAACAATTAGCTAATCAACGTAATTTTATTCCTTCCTGCCTT
TGAAACGTGCGCTGATGCCCAGGCAGAATCCTATATTTCTTAGATTGCATGGTGTGCTCGGAAACTTACAGGCGGCGAAAAAACAGAAAAAATACGTGCA
TTCAAATATTTAGCGCTTCCAGGCTAACTGCCCAACCGAATTTGCAGGGTAACCCGATGAAGCCAGCAATTTGCTTCAAGTTTGATAAGTTTAGACTGAG
GTCTAGCAAATTTCGATCGCGTGTAGGAGTTGGATACACCGGGTGTTTGTCCATCGCGTTGACAATGTCCACCCGGGCTTCCTCTCTTACAGGAATCCGG
GGCGTACAGAAAAGTAGGATTATTCAAACTCTGATTGATAAAACATGGCGCAGCCGCACACTGACTTTGTCCGGATCGCCGGAATATCTAACAACAACAA
AAACTCCCAGCTTCGATTCGTCCAATTGTGTTATTGCCATTTATCAAGTATTAAACTGAACGTGCCGCATCCATGTAGCATTAGGATGATCGGAACTAAT
ATCGGTAACAATGTACTTTGAAGTTGTTTTAACAAGAACAGGATAAAGTAGAAGATTATTCTACAGTAGTAAATGGGCTCGGTGGATCTCTGCGGGTCGC
AATGTACAGCTTATGCGAAGTTGTAGTGGAATGTTTTATCTAATCCATCCAGACACATTCCAATGCGTGTGGGGATTCACACAATATCAGCCTGCCGACA
ATTTAAGTCACGGCAAACTTAGGTGACCAAAAGATTTTTAATAAATCTCTATGCATGCAGAAGAAAATCTGTGTCTGAAAGAGGAGGGCATAAGTTATGA
CCCAGGACTGAACAGATTGAATCGATAGCTTTAACACTAATGAAATGAGTGAGTACTATGTTGAGTGCTGTGGAGCCGCATGCAGTTTAATACGATGCAG
TGATGTGGTAATGACACCAGTTGTGCTCAAGGTCAGCATCGAGGCTTCTAATTATCACAGACGCCATTACTACGACGAACAACGTACATGTACATAACGT
TATCTGTGCAATAGCAAGAATTGCATTCTTTCGAACAATAAAATGTTTGTGCTGGAGCTCCACTCCTCTGGTGGCACCTGGCATCAATCTAGAAGGAAAA
GAAACTCCGAGGCGAATAGGCATCTATCAAAAGCTGTAAGTGTAATTCAGACCGGATTCTATTCGCAGTTCGAAGAACTGTCGATTGGGGAAGGTTTTTG
GATGACATCGAACGACATTCGCGCTACATTTGTAGCTTCCCCTGCCGGCGGATGACATCGAACGACATTCATGCTACACGGGACCATCGGCACATCATAG
ATAGATAAAGGATATTGAAGCCGACTAGAACAAATAATAAGGTGCAATTGTGTATATTATAGCTATTTCTAAGCTGTGAGATTCCGAACACTGAAGCTCG
ACAAGAATGCAATGATTTCTGTTTTACAACGACTGGGCTTCGACCA