Description :
From Genome Similarity Track
Location :
Scaffold_128:262368- 265355
Sequence
2987 bases(100 bases per row)
TTTCCAACACTCCTCCTCGGCCGTCGCCTACGTCAGCTTGACGATCTGGCGCAGCTCCGCCATCCTGGGCGCCGGGAAGGACTTGGTCAGGAGATCCGCT
GTCATCAGGCGCGACTCGACGTACGTGGGCTCCACGATGCCCTTCCGTGTGTAGTCGCATATGAACTGGATCCGGATGTCGACGTGCTTGGCGCTCGCCA
TGCTATCCTCGGACTTCAACTGCTTGATGACGGCCTGGTTGTCCATGTGCATGTGCATGGGCTCGGAGACCACGTGGTGCAGCTCGCACACCAGCTCTCG
TAGCCCAAGCAGCTCGCGTCCGACGTGGGAGGCCGACGTGAACTCGGCCTCCATGGTGGAAAGTGACACACCCGTCTGCTTCTTGCACACCCAGTGGACG
ATCGCTCCATCCATCGTGACCACGCCTCCGGTCACCGACTTCCGGTCGCCCTTGTCGGCCGCGAAGTCCGCGTCGCTCCAGCTCTCCACTTGGACACGAC
GCCCGTCGGACGCGCCGACGTCCATGCGGAGCTTGAGGGTCTTGGTGGCCTTCAAGTACCGCGCGATCCGCTTCGCGAGCTTCCAGTCGCTCGTCCGCGG
CTGGTTCGTGTGCCTGGTCGCCTTGTGCACCGCGAAGCTGATGTCAGGCCTGGTGCACCGGGCGATCCAGAGCAAGCTGCCGACCAGCGACTGGAAACTC
CGAATCGTGGGCTCTCCCTTGGCGCTGACACTCGGCAGCATCTGTAGCTCTTGGGGCTCGGCGTCGTTGGCCTCTTCGCCGATGGGTGTCTTGACGCCGT
TTGCGTCCGCCAGCCCGAACTGCTCCAGCAGCTCCTCGATGGCGGCTTGTTGGTCTAGGCTGTAGCCGTCCGCCTCGTCGAGGTGCACGCGCATCCCGAG
GAACTTGTTTACCTTGCCCAAATCCTTGATGGACAGGATGTTCATGGTCACGAAGAAGTCCTCGACCAGGTCCGGCTTGGACGCGGTGACCAGCAGGTCG
TCCACGTACACGCCCACGATGGTCATATCGTTGCCGTCGCGCTTGTGGTAGAGACACATGTCTGTGATGCAGCGCGTAAAGCCCAGCTCCACCAACCTGG
CGTGAAGCAGCTGGCTCCACAGCCTTCCGGCCTGCTTGAGGCCGTACAGCGACTTCTTCAACCGCAGCGCGAGTTTCTTGTAGCTGTTCACGCCGCACGC
GCGCAGCACCTCCTCGGGCACGACCATGCCTTTGGGGATGGCCAGGTAGATCTCCTAGTGCTGCTCCTTCTCGGCTTTCACGTACGCGTTGGGGATGTCC
CCCATGCCTGGCCGGCACGCGCCAGCGCCGCGCGAACACCAGGATCACTTTGACGGTGGTCAGCTCTATGACTGCGGCGAACGTGAGGTTGTAGTCGATG
CCGTACAGCTGCTCGTTGCCGCAGGCCACCAGGCGGGCCTTGAAACGCTCGATGGCGCCGTCGGCATCGGTCTTGGTCTTGAAGACCCACTTCGTGTGCA
GCACGTGGCTGCCGACTGGCGGCACCTCGACCGTCCACACACCGTTTTCCTCTAACGCCTTCAGCTCTTCTACCATCGCCATGGTCCACTCGCCCTTTAG
CGGGCTCTTCATGGCCTCCCAGTAGTTCTTCGGGTCGGCCCTTCGCACGCTGTTCACCACGTCGGGGGTCGCCACACCCTCGCTGTCGCCGTTGTTCGCC
AGTGACGCCGCCTTCCGCGAGGCCGACCGCGTCTGGTACTTCTTGCGCGTCCAGCAGCGCTTCGCCTGGCGCTTGCCTTTGGTCTTCGCGGCCGCTGCCC
CGCTCTGTGGGTCCACGCTGGTCTCTTCCTCCTTCGTCTCCTCCAAGTCCTGGAGGTGTACGCGCCTGAGCTGCTCGTTCTGGATGTCCGTGAGCGTCTC
CACGTTCCGCACGTGTTGCGTCACCGCGACCACCCTGTCCTTGGGAAGGTACACTTTGTATCCCTTCATCTCGTCGCTCTTGCCGATGATCAGGGCCCGC
TTGCCGCGCTCGCCCAACGACTTGTTCTTGGCGTCACGGTGTACTGTGCACGGCGACCCGAAAGCCACGATGTCGCTGATGTCGGGCGTGCGCTTGGTGA
GCATCTGCAGCGGTGACTTGGCCCCTGGGTTGCCCTTGCTCGGGCTCCGGTTCAGAATGTACGCGGCGTACTCTGCGGCGTCGCCCCAGAAGCTCAGTGG
CAGCCCGCACGCGAACACCATGCTCCGCACCATGTTCATGATGGTGCGGTGCATGCGCTCGGCCTTGCCGTTGCTGGCCTGGTTCCTGGGCTCGCTGATC
TGGCGCGCGATGCCGGTCTGCTCGCAGAAGATGTCCAGGGGCTTGTACTCTCCTCCGCCGTCCGTGCGCAGGACGTGGATGCGGCAGTTGAACTGGCGCT
CAAAGAAAGCCATGAAGTGCTTGAACTTCAGCGCCGCCACATCCTTGGTCTTGGCCAGGAAGATGCGACAGTAGTTCGTCCGGTGGTCGACGAAGTTGAC
CATGTAGCGGTTCCCCCGCCTGTCCCTGGGCGTTACGGGGCCCCTTCAGATCCGAGCAGATCACGCCGCCGATGACGTCGGTGGGCGAGTTGGCGCCCGT
GTCCTTGCGCGACTGCACGTTCTTGGTCTGCTTGCCCTGCGCGTAGGTCAGGCAGCTGTCGCGCTTGTGGTCCGTGAGAGCGATCCCCGAGGCCGGGTCC
TTCGCGATCTTCACGATGGTGTCGTAGTTTAGGTGGCCGAGTCTGCGGTGGAACTCCATAAGCGTCCCAGTCTGCACGTCTGATTCGACACCTTCCTGGG
CCTCCGCCAACGCAGCCATCAGCACGTCTCCGGCGCTGCGACCGCTCTCTTGGTGTGTGGTGTGCACCACCAGCACGTTGTTGCGCCGGTGCACGTCCAA
CACCGCGGACCCCTTGTCTGACGTCGCCGCTATCCCCCGATGCGGGCCTCGGTACTCCATCCTGAAGCCCTTCTTCTCCAGCAAGCC