Description :
From Genome Similarity Track
Location :
Scaffold_4:26235- 28472
Transcript NameFunction/comments
Physo_262607Eukaryotic/viral aspartic protease, active site

Sequence
2237 bases(100 bases per row)
GTGCATGGTGCCGGCCAGTGCGAGCACCACAAGCTCTACGAGGAGGCTGTGAAGTTCCTGAAGTCGAAACACGACAAGGACTCCCTTCCGTCCGAGCTCC
AAGGCATATTTTCCAGCAATTTAAACGAGCGCGCCCGCCAACTATAACTGGGTTGGGCACTGACGGGCGCTCACAGTTGTCTGAGCCGGCGATCGAGGCA
AACTTCGTGTTTGCCTGAGCAAATGGCTGGGAAAGGACAATGCGACGGACATGGAGTTGAAAAACGACGGAAAATTGAACACGGTCGACGAGCCAACCAT
ACTGAATTCAAGTCAGGATGTCAGCGAATCTACCGGGATGATCACAAGTGCGACGCTGCGTGAGACGAGGCCAACCCCGCGAGTCAAGGTGATGAAGCTG
CTCGCGGGCGAGCGCCAAGGATGGTGGTCGCAGAAACAGTTCGATCGGCGAAAGCGGGTGCGAGCACTTGTGATGGGAGCAGTGAACGACAGAAAAACGG
AGATTTTGCTGGGCACGGGCACGAACGTGAGTGCGGTCAGCGAATCTTTCGCTAAGAAAATACGGCTGAGACGCAGGGTGAACATGGACATGCAGCTGGA
CATACAAGGAATTGCCAAGGACGAGGTCTACACGAACGAACGTGCGAAGGTCAAGCTGACACTGGGTTGGGAGTTGGTTTACGATTTTGAAGTCTAGATC
ATGCCTCACTACGCGGGGGTGGACGTTATTCTTGGGACTGACTTCATGATTCCAGCCGGTGTCAGGCTGGACCTCTTCCGGTCGACGATGAAGAACCCGG
AGGAGGTGGTGGTGCCGCTAGTCAAGTCGCAGAAGGAAGTCGACGAGCGTAGCGCTGCGGAACATGTAGCTGGGAGCCCGCCGGAGACGATGGAAGTACT
GGCGGGCGAGACAGTTGAGTTCAAGTTGTCCAAGAACTGACCAAGCTGGGCGACCCACGATCTATGGGCTCGGCGAACTAGAGATCTGTTGCCGACAGTG
GTCTTCAGCAGGTCGGGAAAACCGACGAGGGTCAGATTGACAAACTGCACGGACAAACCAGTGTCCTGTCCGGCACACTTCCCGTTCGTGTATTGGATCC
CGCACGAGGACCTGCCGCTCAGCGATGGATACGTGCAATTGCATACCAGGAAGTATCGTGAGTGGCAAATACTGGTTTATGGATCATCGAAGGCGAAGCA
TCTACTGGAACACGAACGTCGCCTCTATGAAGAATGGTCGGCGAAGCAACCTCCAGCAGTCGAGCAGCGGGAATACGCAACCCCTGCTGGAGTTCATGCC
GACCAGCCGATGCACCAAGAGGTCCTACCTGCGAAGAACAATGGAATCGACTCGGCGAGCTATCCGACACCGGAGCCGACGAGACAGGGGTGACTGATGA
AATCTCGTCGAATTGCGGCGAGAGCGACAAGTCTGAGGAAGCGACAGTGGTAAGCTGTCCTATAGACGCCGGGGAACAAGACTATGCGACCCGCGTCACT
CCTCAAGAAGGTGAATTTGGTGAAGTTCGGTCGGCGAACGAAGTCCAAGTTGCCTACGAACACCCAAGGTTCTCGCCTGACGATGATAACACCGCTCACC
TGATAAGCATGCTCCGACAGCAAACGGATGGGATGCGCACACTGAGTGCCAGACCAGACCTCATCAAGGGTGTCTATCTCGACGGAACAGGAGGTGTGAC
TGAGCCTGTGTACGTTACCGTGGCGGCGCTGCAAGAGATGGATGACGAGATCGAAGAATCGATGAGCGACGATCCGCTCGACGACCTACGACATTGCTAT
ATCGCCTCCGCGAAGGCTCTCATGGTAGATGGCGACAGTGTGGATGGAGACGAGTTCGAGCACGAAGCAACCGAGATTCATTTTGAAGATTACGCACACG
AACTCGCCTTCTTACCGGACTTGACCGCGCCTGCCTCGACGATCTTGGACTATGATGCGCCAAATGTGAAGAACCCCTCACTGGATCCAATTGGACAGAT
CAAGCTCGTCGAGACACTGCGTCGGCATGAAGAGATCATGATCGCCAGTGGCAACGCACTACCGCCGCCTGCGTACGGCGCGGTGTGCGACATTGATGTT
CAAGGCAACGCCCCTATCAAGCAAAGAGCTCGGCGAATTCCGCTGAAATACTTGCGGAAGCTCTATGAGCTGCTGAAAGGGCTGCTGGAGGCAGGACTCA
TTGCGTTCTCATCCAGTCCGTGGGCCTCGCCGATCGT