Description :
From Genome Similarity Track
Location :
Scaffold_11:262299- 266675
Transcript NameFunction/comments
Hyaar_Emoy2802164metalloprotease family M12A, putative

Sequence
4376 bases(100 bases per row)
TACTTTGCAAGATAAATCTCTTGTACATGTTCAACGTCAACAGCACCGGTTACGGTACCGAAAGAGTCCCACGGTTGTCATTTCTTTATATCAAATATGA
CCTTGACTAGGTAAAAGCCAAGAGCATCAGATCCTAAGCTATTTAACAGACAAAGACGATTGAAAGTGCAAGTGATGGACGTCAGTATAAAATATTTGCT
TTACTGTCATCGGTCAAGCGAAAGGCACTCGTTCGGGTGATTTACAATTGCATCTGTGCTGTAGCAGATATATGTAGAATGACAATATGAGAACGAAACG
CTTGGACTTAAGAACGATAGATGGTTGTAAGTAAGTACCATCTATCGTCAGCAAAAGTGATGTTGTTATCTGACGACTAAACAATAACTATTGTCTTGCC
ACAGGCCCAACAGACCTCGGAATGAGGCTCTGCTTATGCCTACTCAGGTCAATTTGATGATGAATATAGTAAAAATACCCGGCGAAGCGGTACGTATTGA
ACATTTTACATTCATCTAAAAATATATATGGATCTATCAAGTACAACTCGCCGTGGTTGATGATCGCGCTGATCACTTGGGATAATGTGTCAGTGTAGGA
AACATTTCCTTTCAGACAAAGCATCGACGTGAGCTCGCTTCCTTTGGCGGGTACGTTACCTGACCGACACAACCATTCAGAGTCAAGTAGGATGCGTTTC
AGATGCTTTGCCATCAACGTGTGCCGCTTCCTTTGACACGCACAGCTCCTGGTTTGTAGTCGGCTGAAGACTGGGCTCCGACCACTGTAGGAGACACCTT
CGGCTTGGACATAATCATATCAGAGACAGAATCTGGAGCTCCCACACTTCCATCGCCAGATAAGTCCACAATTGGAATCTGGACGTCCCGCACTTTTGAA
TTATCGATAGTACCGTAAAGAGCGCGGAGGGTGTAGATATCGCCAGCACTGAGCACTGTGCGTGTTCCAATTTCGGAATCCCGACTTGTATCACAGTGCT
GCTCCACCGGTTGGACACAGTTTTTGACAATCTCAATGTCACAAAAAGCCTCGAGCGGGTACTGCGGTTTAGGAAAGCACAGTCCCGCACTGCGGCCGTA
GTGCATAATGGACTTTGGATCGTACGGCTTGAGTATAGCTTCACGACTCGTCTTCTTGGCATAGTTTTCAGCTGAAACAGGCAAATTCTGGTCTGTGAGC
ACAATCACCTTTCGATCCTGGTGCGTGTGTTCGTGATACATTCCCATAGCATGACCGATCTCGTGCACGACGTTGCCTACCCCGCCAGCAAAGCAGCTCT
CGCCTAGATTCATGAGCTGCGGCTTGCCATCGTTCACATACCCCACGACACCGTAGCACGCGTCTTCGTTCTGCTCAATGCTAACGTACTTGCCATTGCA
TTTCGAAACTGGATCACACTCTTGCAGCGTCACGTTTACTTCTGCTTTGCTGTAGAGATCCACGGCCGCATTAATGACCTCAAGCTCATGGTCAGAGAAG
GAGCCGTTAATGCGGTACCACACAATGTGGTCCGGCCAAATGTCCTCTTTCAAATTCACGGCTACTCCCAGTCGCCTGCGCTCCTTCACGTGCTTGCAGT
CAACTTGTTTATTATTGATCCATTCCGGTGCATCCGCTAGTCCTTGGTCTTCAAAGCAGGTCGCTAGTCCAGTCGAACACCGAGCGAAGATGCTATTACG
ATGATGAGCTTGACCGAGTATATACTTGATACTGCCATGTTCGATCTTAATGCCGTCGATTTCACAGTCTGCAGGACTAGCACATGAACTAGAGGCCAAT
GAGGCCAGCAGCAACAACGTTGGAAGCATAACCGGTTGTAAGGACACAATTGAGACTGAAGGGTGGACTGACTACCTGGTTCAGATTGGCTGAAAACAGC
AGTGCGAAATGGGACACGACAATGTAGCCATGTCCTAATCTAGGTACGACAAGCTGAAGTGCGAAAGATTATAACCTGTACAGTATTTAGAGCAAATGAG
GAATACAGGATTTGTTTTCTGACAAAGCGTACAACTGCAAGATAAATAGGCAAGTGGCTACATTCGAGGGTAGGTATATCTCGAGTAGCTGTGCTTTTAT
CGAAATTGCTGAGTACGACATGAGCAGCGCAAATACACCTGTAAGGAGGAACTTGCTGGATTCCAGCTCATCGAGTCAGATCTAGAGAACGTGGGAGATT
AGTGGCTCATACGGCCAAAGCGTGACCATCGACACTGAAGCTTGGGTGCTATATGTCACCGATGAAGGTGATGACAATTTGGCTTGTTTACAGAGTCAAC
TAGCAATCAAGAAATCGCAATTCAATAGCTCAGCTTAATATAGCCGGAAACAAATTGCGTCACAATTGCATAGACAGACATTCGTTAGCTTTTTCGATGA
AGTGGTGCTCCATTGCCTAGTAGTGAGCTGGTGTAGCCACTTAGTACGTCGTCAGAGATCACAATCAATATCTGTGCGAAAGCACCAGAACATTGCGCAA
ACAGTCTTAACAAGGGTCGAAGGCTACGTACAAATAGCACGTCGAGAGCGGCGACGTCTGTTCTGCAACGAGCAGCTACAGCACCTGAACCTATTAGCAT
CGATAGTGGCATACTCTAAGAGCGATGCGACACTCACATCCGATCTCAACCATTCGGATGGTGGTGGCATTGTGAATATACCATCGCTCACATAGTCGCC
CTCATGTCTTGTCGACACAAACAACAATAATGTGTACACTCGACTTCATAAGATAATAGGATACTGCCATTTACGACAAATTCAAAGAATCGAACAAAGA
AATGGATGCTACTTATCCGTGAACCTTCCACGCACGTGAATCATGCCGTATCCATCGATTTTATCAGGTTGTTAAAAGTCCCCATACATATAGCATATTG
TTATGAGGAGATCCGAGTATAGCCGCACGCGTTATTGCTGTATAAAGCGTGTAAAATGTTCGTTTGGGGATCTATAGTGCTCTTCAAGTCGTGTTGATTG
TGTCAGTGCAAAGAATGTCGTTAAATCGATGGCCGTATCCATAAAATGACTAAAGTCACGGTGGGTTGCGAATGGTTGCACGTCAGAATCGCTACGAGCT
TCCACCAGAGTTTCCCCTGGCTTCACCCTACTCAGGCATAGTTCACCATCTTTCGGGTACCAACATATGTGCTCAAACTCAAATCTTTCACCGACTTACC
AATTCGGAATCTCTCTGCTGGGATGTGGATTATCAGCTGCGGCTACAGCAAGGAGATCCTGGGCTCGTGATACCGTGAAATTGTAATTTGTACCATTGTC
ACGACCGATGCTGCATCAAATATATCTGGATACATGCAAACTACGAGCGAGACTGTAATGCCAAGTCCGAAGAATCTTCGTCCGTAATGCCAGTTTCTTA
TATAAAAGGCACTTGCAATACAACATATCAATTTTTGCGATCTTCAGACGTCCTTCAGATTTATCTGGCTATGCAATGATCAAGTAAATGAGTAACGTCA
GGTAGCAGCCGAACTCCGAGTCAAAGTACGTGGTAAATTATCATGAATGCTGGAAGGGGCCCATCGTTTGTTGAACTGCAAATTTGTACAGAACTTCGTC
GTCTATCACAGGTATCAACAATTAATGTTCCTTGCCCAACTGCTTGTCAAGTGGGACGAAAAATGGCGTCAGATTGCTTTTGTTGTAATTTTAACACAAC
ACGGTGTCGTAACCCTTTGTAAAGAGAGATAGTTTTTATTATTCTTTTTACATTCTCGACAGTGGGGCCGACGTGACGAACGCCACGACCCGATGCGTAA
TCTTTCGTGCTGAACTGCTGTTACCCACTGATGACTCGATATGGTGTGTTACAAAACAGGGCGAAATTTCTCACGGGCAAGTGCAAAAAGGATCGAGCTT
TCGTGAAGCGGGTCTTTTTCTGCGGAAAGTTGAGCCTGAAGCGAATGTGACAATCTCATTAGATAGAGCCGAAGCTTGCCGGTAGCTTGCATGCATTGCT
TTGATGTCATTTGGATAGATCCCGCTGGTCGGTTTCCTTTTTGAATGCGGTGTATTCGCATTGCACGTGTTCGCCACGTATCAACTTATAACTTTCAAGC
ACCGTAGTATGGACGAATTTGTACCAGCTGTCTGCTACAGAGCAGGTCGGCAGATAAGTGAGATGTATATATCGATGACATGCGATGTGTCGCCTTTTAG
CCATAGTGCGATCGTCGTGATCAGCAGTCGATATCGACATTATTGCTGGTGTTCGCATTAGTGCTGGTCGGATGCAAGATGGAGCTCTTAATCACTGATA
CGTATGTGATGGGTAGGCCGAATACGCTTGTGACGTCGTCCCTGAGCAGTCCAGCGTTATCGTCGCACAACGTTGA