Description :
From Genome Similarity Track
Location :
Scaffold_78:262175- 263861
Transcript NameFunction/comments
Phyci_233579ABC transporter lipid export ABCA family

Sequence
1686 bases(100 bases per row)
ACGTCGAGGATCCTGGTGGTCTTCATTCAGGAGAAGGAGCTCCGTCTCCGCGAGTACATGAAGATTTTGGGGGTCAAGGAGCGCGTGATCATCGCCACTT
GGTACATCACGTACACGATCATCATCTTCGCCAGCGCCGTGCTGCAAGCCCTCGCGGGTCTCGTCGGGCTCTTCGCCAACAGTTCGGTGATCGTGATCTT
CCTCTTCTTTTTCCTGTTCGGACTCAGCGTGCTCTGCTTCGGATTCTTCATCAGTACTCTCTTCAGCAATGCCCGCACAGGCTCGTTCGTGGGCATGATC
CTGTTCTTCCTCATGTACTTCGTCGCGCAAGCATTCACAGATAATTCTCCGGAGCAGGACATTTCCAACGCGTGCATCTTGCCGCCGGTTGCGCTTTCGT
TCGGTCTGTCGACCATTTCGGACTTTGAATCGTCGGGCATCGGCGCGAACTTCGGCAATCTGGACACACTCAACGTGAACTTTCGCCTCAGCACGGCGCT
GAAGATGTTCCTAGTCGACTGCGTGTTGTACACCCTGTTGGGGCTGTACTTCGAGCGGGTGATCCCGAAGCAGTACGGCACGTCGCTCAAGTGGTATTTC
CCGTTCTCTCCGTCATATTGGCGCGGTCGCAAGAAATCTTCGCTTTCAAATGGCACTGAGACCCCGACGGACTCGTTGCTCGACAACGTCGTGTTGGATG
TGAACCCGAACATTGAGCGGGTCAGCGCTGAGCTTCGTGAGCAAGAACGACGAGGCGAGGTGTTGTCTGTTCAGCGGTTGGGGAAGGTTTTCGAGGTTCC
TGGCGGCAAAAAGGTGGCTGTCAAGGGGTTAGACTTGGTCATGTACAAGGATCAGATCACGTGTTTGCTCGGCCACAACGGTGCTGGAAAGTCGACGCTG
ATTTCGATGCTCACTGGTATGACGGCGCCATCGAGCGGCGACGCGAAGTACCGCGGACTTTCACTGAACCAAGACATGGAGGAAATCCGGGAATCACTGG
GCATTTGCTTCCAGCATGACGTGCTTTTCGAGGACTTGACCGTCGAAGAGCACCTGGTGGTGTTTGGACGAGTAAAAGGATACCGGAACGACGAGCTGCA
GGGGCTGGTAGACTCGCAGATCCGACAGGTGGGTCTTACTGAGAAGCGCCATGTCCTATCGAAAGAGTTATCCGGTGGCATGAAGCGAAAGCTTTCGGTG
GCTATTTCACTCCTAGGCGATAGTTCCTTGGTGTTTCTGGACGAGCCGACTTCGGGCATGGATCCCTACAGCCGCCGTAGCACGTGGGAGATTCTGCTCA
ACAACCGCAGCGACCGCGTTATGGTTCTGACGACTCATTtcatggatgaagccgatatcctaggagaccgcatcgctatcatggcagaaggcgagttgcg
ttgctgcgggtcgtcactgttcctcaagaaccgatacggagcaggctacaatctcaccctcgtcaaAGACGACGCCAAGTGCGATGACAATGTCATCACC
ACACTCATCAAGTCGTACGTCCCGTCCGCTGAGATATTGAGCAACGTCGGCAGCGAAATTGCGTTCCAGCTTCCTCAGAAGAGCTCGCCCATGTTTTCAG
CCATGTTCACCGAGATGGACAACAATCTCGCCAAGCTTGGTTTGCTTTCGTACGGGATTTCGGCCACGACGCTGGAGGAGGTGTTC