Description :
From Genome Similarity Track
Location :
Scaffold_26:262172- 264810
Sequence
2638 bases(100 bases per row)
TGGGGAGTGACTGCCAATCACGGCGACATCCCCAACGCGTATGTCAAGGCAGGTAACAACGAGCACCTACAAATTTATTTACATGTGCCGGGCGGGATGA
GAATATCAGAAGAAACTGTGCGTGAACAAGGCGTAAAGGGTGCGGAGGAGCTTGTCCTGGAGCTTAGGAAGAGTCTCTATGAACTGAAGCTGGCTGGTCG
ACTATGGAGCCAGCTTCTGCACGAGCGTCTTGTCGAGGCAGGATTCAAGCACTGTGAAAGTGATATGTGTTTTTACTGGATGAACGAAGGAGAAGATCTC
GTCGTCGTGGGCGTCTATGTGGACGACCTTTTAGTGACCGGAACGAGTGCAGATAGAGTCGACCGACTTTTTAAAAGCCTCGCGTCACTATCGATTAAAG
ATCTCGGATACGTCAGCAAATTTATTGGGATGCGGATTGAGCTTAATGGTACAGGCGGATACAACCTGGACCAGGAGGAGGCGATTGGTGATCTTTTGCG
GACCAATGGGTCAGCAGAAGCAAATTCGACACGCGCTCCGATTGGCGATGATTGCTACGATGCGCCATATGATGATGTGGAGCTGCTTGGATCGACAAGC
ACGGGCAGTGGCCCAAGGTACGCGATTTTCAATCGCTGGTCGGCAGTTTGCTCTGGATTACGCGCTGTACGCGACCCGACATCGCATTCGCGGTACACAA
GGTTACATGACAGACACACGCGCCGCGTATGTTCGACTGGAAACTCGCTAAATGGATTTCTCGATACTTAAAAGGCACAACATTTTTGAAGATTACAATG
ACGCCGGCTCAAGAAAAATACTGTCAAGAACTGCAACTGGAAGCATTCAGCGATGCTGACTTTGCGGGAGACTAGGCCGAGAGGAAGTATATCACCGGCG
GCGTGCTGCGTTTGAATGGGATGGCGGTGAGCTGGGGAGCTCGCAAACAGGGAGGAGTATCTCTGTCGACTATGGAAGCCGAGTTTGTTGCCGCTTTCGA
GATGGCACGCGAGTTGCTCGGACTGCGTGAGATGCTCAGCGAGGTTGGCATGGCACTGGCATTGCCAATGAAGCTTTATGTCGACAACCAAGCGGCCATC
AGTCAAATTTCGGGTGAAGCATCATCGGTGAATGCCAAGCACATCGATGTTCGACTTACTTATTCGACTTAAGTTCTTATGTTCGCGCCGCGGTGTGATC
GCTGCGTGCTACCTGAGGTCGGAGATGATGCTTGCGGATCTAATGACGAAGGCTCATGATGCTACGAAGCTCGCATCGCTTCGTGGTTTACCATGCATCG
GCTAGAGGAAAGGAATGGAAGGCGCACTCGAGGAGGAGTGTTAGAAGTTAAGGATTATTGAGGTGGAAGCTGCGATTAGCGCCAGACATCATTTGCCGCA
TGCATAGTGAATGGGAGTAGTTAGTGCTAGCGACCAACCGATTTGAAACGGTTGGAGCAGAGAGGGTAAGGTGAAAGAGTAACTCACGGAAGAGTAATTC
ATCTTAATTCAGAATCTTATCATCCCTTTCCCTAAGTAGTGTGTATTGTCAACAGGTATTGTGTTGTGTGACTCCATTTGTAAAGGGGTTACGCATCGTA
GGGTACTCGGTACCCTATGTCTTAGACACACGGGATGGTATCCCACTGAAAGAGATATAGAATATCTTATCGGTTTATAGGGGCTGGCGGTGTCAGCCAC
AAGATAGGAAAGATCTTAAAGATATTAATTAGGACATGAGTGCCTAAATTACGTAATATTAGGATTAAGATATTCTATAGAGTTAAACATAAATAAAGTT
CAGTTCCCCTTTTGATCTTGTCTAAGACACGTGCCTTGCGAGGCGTCTCTGATCGTTGATCGTTAAGAGTTAGCAACATCTCCCTTAGGTAGCTACTCTT
GAACACTAAGTGTTGTAGGTTCGCTGAATCGTTCGGTACCCTGGCAGGGACCTTAAGCTTTACGCTTGTTGACTCATAGAGTCTAGTTCTTTAGAACTAA
TATCGCTCCTTGAGCACTAAGTCTTCCTCTGACTTAAAGAGCTGTGTAGCTCCGCTACACCATTTGTCATAGTCAAATCCGGGGCAAGTATGTCATGAGC
GATTTGAAGCTTTTGCCGGGATCGCAGACATATGCTGGTCCCTTGATGTTGTACTCCACGGAAAACCTGTTCATAGGCAGATTTGATCTTGTCATGGCAA
ATCTATTGCCAGAACAAGGTATTTTGAGATTCCTCAGCATCATGTCAATGAAGTAGGAGCTAAAAGTGATTGTGGATCAATGTTAGCCACCATGCGTACC
GGTGCTACATCGTCGATTCTTCTCTGTGGTCGGTTTAAAGTGCTATTGAAGCTACCAGCTGGACATATTAGCCGATTGTTGCCTATCCCGCGTTCGTTCC
TTAGTCATGCACAGTAATGTGACAGAACCAAAATCCCATTAGATTCTCATTATATTTGAAAACAGCAAGAATAAGTGTTGTGATTCTATTATTGTCGAAG
TAACGCTAGAGTGACGGTCACGAGTTCAGCTGTTACGAGCCGGTAGAAAGTCGCTGTTACCAACCAGTAGAAAATGGTTGTTACGATACAGTAGACAATC
TGGTAATCGATAGAGTTAGAGATAGCCATATAGTTTGC