Description :
From Genome Similarity Track
Location :
scaffold_48:26217- 27218
Sequence
1001 bases(100 bases per row)
GGATCGTGATATAGCTGAATCAAGCCCACGTATATAGTGTTTGCATTCTCTTTGGGATGTCACAAGTACATATCAATTCCTTTCTCGCTACGACCGACAA
TAAGATGATGTATCATGCTTGTGACTCAGTCTTGTAGACCGCAAACACTGTATGCTGGTGGAATGACAGCGTTTGAACAAGTCCTTTGATACACATGCAT
GTGTGTCTCGTATGCATATCTTACTTTTGATCATCCTGACCCTCAGCTATAGcgtcacgcactcagcgctaACGCTCCTATTGGTATAACATCTGTGATT
TAGTTACAACTTGTAGCGGACTTATTCGAGCGAGTCAACTTGTATCGGCAACCCCTACCCCACCATGAACGATCAAACTTTGTGGTGGTGACAAAGGAAG
CTAACACGATAATTTATCGAAATAATAATGTCTGTAGTGGTATGCATCATTCAGCGCTAACACACTGGGTGACTCGCTCCGGTACCGTGAGCTGTCCGTG
CTAGTATTCCGGAGGGCACCGTTTACCACGAGATTCACGCGGCTGATAAGATGAATATGGTCCAGCATTCAGACCGAAGCTCGTCAAAACTTTATTTCGA
AGCGCACATCTCGATCTGACACAATGGTTACCAGCAAACTATGGTGGCAATTAGACGTGTCGccgacagcagcaagatgccccatcttgctcagacggtt
CACAATGATCTCATTGTGCGGTATCAGCAAGCGCTTCTTTTAGAAGACCAAAGAATATTGACCATTTTGGTAGACTGTCAACGCTCTGCCATTGCTTTAA
GCTGCCCACAAGCCAAAAGTACTGCCGCATGAGACGAGGGTTTGATCCGTGGTTAAGTGTCGCACGTGCGCATATATGTGCTTGCCAACTTATACGCTGC
GCTCACCAATCAGAAATATTTTCGCGAACGCCACGCGAACGGTTTATAAGTGTATCGTACAGTAATCTGTATCTGATGTCCTCGTCATGAGGCACCACTG
C