Description :
From Genome Similarity Track
Location :
Scaffold_33:262100- 263688
Sequence
1588 bases(100 bases per row)
GTTTGTTTGTACAATGCATAGAGTAACCAGTAGATATAGAATGCCACTTCTTCACATCATCGGAAATGCCGCCTTTAAGAAAACCTTCACCGTAGACTCC
GTCTTTCTTACCACGCAACGTTTTGGCAATTATTTACAGATAATTCAAGTTAAAACACTATCAAAATTGTATGCATCATTCGCCCCAAACCCAGTACTTA
AATACATATGAACAACGTTTTCGTTCATTGTAATGAACTTCATGTCAAAAGCGAAGCAGTACTGCAATCTTGGCCATGACCAGGACCTTTATAAAGGTTC
ATGTACTGTTTAACACCAGGCTATTAGCACAACCCTCTCTGCGGTCGAACATTAAATATCCCATAGTGTTGCGTAAGCCGGCCTCGCTCTGAAATGTACC
GAATATGTAAACCGTATATAGAAACCAATCGATACAACCGAGTGCAATAGTAACCGAGTGCGATAGTAACCGAGTGCGATAGTAACCGAGTGCGATAGTA
ACCGAGTGCGATGATAAAACAGGTTAATAGGTACCCCCGACTGTCATACACCAACAATTAGAGGGAGATACATACCTCAATCCCAAATATTAAAATTATG
TTTGTATATGCTTATATGTTAGAGCCAGTATAGCTCCCATTGTATCACAACACTTTGAAATTTTAATAAAACGCATGGTATTACAGCACATCCTGATTAC
CAAAGTCTGTATATTTAGCGAGTAGCGTAGTTATTTATTATAACTAAACTTTATATTAAGAAGGCCTTTTTCCAGAGATTTTATTTTATGAAAGAGTGGT
GCTCGCGATGAAGCGTCAAGTTGGTCATATGAAGCAAAAAGCTTTCCATAAAGACCCACTTCTTCACATGAGTGAGTTTGGCGTTCGCAAACTGTTTATT
CTTAAGGTAAATGTCACTAAAAAGGTCCAGTGAGCCCGCAAAAACAATAGCGTAGTTGTTAAGTTCTAGAATGGAAGTCAACTATCAATCTGCTTGACGA
ACATTATTTCATTTAACACCATGATCCAGCTCCACAGACTTCTTACGATATTTATCATTACCCATATTGACCCAGCTGGTCACCTCAAGCGAATGACCAT
AGAAAAATTTAGGCGGATTGTAATCGATCAAGACAAGTTATGGAGCATTATATACGTGCATATGCGACAAACTTTCGAGCATCTTACTAGTTTTGGGAGT
GTCTTTTGCAGCTATTAAATCCTACTACAGCAGCAGTGCGTGCCACCTGCGTTTTATCTGACTTCAGAGTCACGCACAGGGCGGATAGAAGGGACCGAAT
AGCTTCAAGGGGTCAGAAGGAAATCTCCACATAACGAAAGATGAGACTGAAAACTTGAAGGCAGGCACTAGTGTTCTTAATGATTAATTATTTACAAACA
TGCCACAGCTTTATCGGGGTAATACGTAGTACAATTACTAAGACGTGTCTACCCAATTACTCTGCTCTCTTCGACACAGATTTTGGTGTTTGTTTATGCA
GCTATGCTAGTTGTCGATTTTAATTTAATTTAATGTATGTGAAAATACCGAAATGATTGCGTATCTATCCCGGCTTTCCATATTTTTT