Description :
From Genome Similarity Track
Location :
Scaffold_72:26204- 32839
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_72-snap-gene-0.39Pinin
Pytap_DAOMBR444maker-pag1_scaffold_72-snap-gene-0.555'-AMP-activated protein kinase subunit beta
Pytap_DAOMBR444maker-pag1_scaffold_72-fgenesh-gene-0.6Microtubule-associated protein EB1
Pytap_DAOMBR444snap_masked-pag1_scaffold_72-abinit-gene-0.91Gene of unknown function

Sequence
6635 bases(100 bases per row)
gATTCCTGAGATTACAGAAAAGACGTCGTCGAACGAGTCTGTATCGGTTGATATCACTCCAGACGAACCCTCCGTTGTGAagAGTGAAACCCCCGcTAAC
CCTTCGGCCGACGAATCtACCGACACCACAGAGCATTCATCTGCTCAACCTCAGGCAAATGAAgAGACGAATGCTTCTGATCAGCCACATCCTGCACCTA
AGGCAGatGGACTGGCTCAATCCACTACGCCACCACACGATGATCCAGCGGCTTTCTCCACACCTGAAAAGCAGAAGGTGAACGTCAGCAAGATGAAAGT
GACAGAACTACGCGAAGAGCTCAAGAAGCGTGGTCTCAACGCCACAGGCCTTAAGGCAAGTCTCGTCAAGCGACTGGAAGAGGCACTTAACGATGCTGCA
CAATAATAAAAaCGATGAGTCGATCTTGACCTGACGACGCGCTTCGATCTGGATATCTCTGAGTATGGTCAGATTTGTCTGAGTCGAGGATCCACTACCG
TAGACGTCAGATCTAAACGACCGCTTGAGTTGATAAGGGGGCTGTGAGATGTTGACACGTGAATCCGCGAAGCGCTCCTCGTCGCCAAGTCGATCGCCAT
GGTGAGACGTCGCGTTGCTGAAGAAGCGCTCGCATGCACTGACCAATGCTGCACTTGTGCTGTCTGTAGGAGATCCCATACTCGAGCCCCGTGAACCCTG
AGCTGTACGGCACGCTGACGgTGGCGCTGCTGCTTGCCGGCCTCACCATGATGTCGCTCTTCTttACCAaGGCTGTTGCGCCCAAGAaGAACTTCGTGGT
TGAGCTCGCGCTCGCCATCATCGCGgCATTCCTTCTGGgCTTCGGCTCGCTCTTCCTTTTCCTTTGGGCAGAAATCTACGTCTAAAGCGCATCGATCGCG
CCAGTCCCTCCcGCcGCTCTACACACACACACCGACGTCTGGGcTCCCCACCTTTACTAGTATTATCCTGCACGAGATGCAGTTTtGTCAGCGCGCTACA
GtAaCGTTaGCTTtCCCTTCGGCATGAACGAATACACACACAAGGCTTCcTCCCcAAACTtcGTTTGTGCTCtATTtACAAcGGATaCGgAaaaCCTCGT
GCGCGTGGCAGTAGGGCTTTCGGGCGGTGGCGgaTTAGCTCTGCGAAGGAGACCTATTCAATGGCCatCAGgTATTGAaGATCGACGAACGAAGGCTTTC
GACGCCTAGAAGCAGCACGAAACAGAACGTTTCGCGATGCCAAATCGCACGAGGAACCACCGGCCTGGgTGAGCAGCTTCAGGgAGTtCACGGGATCTTC
TTTTGACGCGATAATAAGTAGTAGCTTGGAGCGACATAGAGCTCGTGTGCTTTATGATGCCaGAAACAGCTTTATGTAGTTCCTGGCATGAGGCTGTAGT
AGACGGTAGTTACGAACTTCTGCTTGTAGCGCTGCGTGACACCCAAGACCATCATGCCATCCTTGATGGCCGTGCAGTACAAGTGGTTCAGTGCAACGTG
CTGCGGCACGGGCAGCAATCTCGTATCGACGCTTGGAGGATTCTGCACGTTCCATCGTCAGTCGTTTAACGCCTGCGACGTCACAACCAGTGTACATACC
TTATTCAGAATGATATGGCGCAGATGTGGCGGGAGCGGTGGTGGTTCCTTCGTATACTCGTCAATATCGGGAATAAATCTTCCATACTGATTGTCATCCT
TCTCGGTATCTTCCGCAAAATCAAAGTCCGAGAGCGGTTGGAAGTCGGAGACATCCACGAAGTTGTTGACATTGCCTTCGACGTCGGCGACTGTGAGTTG
GTCTGGAGCGAACCGCCACTCCTCGTCGACCACAAACTTGTACGCGTGCTTCCCACGCGTGAGgTTAGCGATGTACGTGAAGTCGTTACCAGAGCGGTGC
ATTGGACACTGCTTCGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGCTTtGTATACTCGCACCAGGCGTTCCGAAAGTGGCCGTTAGA
GAAACCGCAGAACAGCACCTTCGCGCGACACGCCAAGGAAGTACTGTATACCCTCTGTAATCGGTAACGTTCTATTCGTAGATATCTCTGAGCACAGgTA
aaCATCACACGTCACAGATCGGGATCGATGCTGGCAATGCCGAATGGTGACGGAGCAGGCGCAGCAGACTGACCGAGGATGCTACGTTGGAGAGATGTGA
GACCCGATGAAGCTGCAGGGCcACcGCCGAGATTGAATGTGAAaGTAGCAGGCTGCAaGAAaCTAGGCGCTGGTACTGCCGCCACAGGTGGAGGACGCGC
GTCTTCGTCGTCATCCAGAACAGCGAATACGTTCCGTGGCATTTCCACTTTTTGCTTGCGGCTCTCACGAGGcGCACTAGGTTGCGGAGCTGAAGCGGGC
TCCTGTGTGTGtgTAGCATCGAATGTTAGCACTGCGGTTAGCGTTaGCGAACGAAGGGGAGATGCGTGGCCCGTACCTGCATCGCTGACAGAAAGCCGTG
GAATCCCTCAACTTCTCGTGGCGCTTCTTGGACAGGAGTAGGCTGATTGCTGTGAGCAGAGAAGATATGATGAGCGCGTTGTTGACCTACTCTTTTGCAC
AACGACgtACTCACAATTGAAACGTGGCAGTGGGCATCACGAAAGACGGTGGTGCAACAACTGCATTCGCAGCGGCTTGAGCTGGGTTGGAAGCTGGTTT
CTTCATCCGCGTTGCAGCCATACGCTCGTCgAaGTTACGAAACTCGTCATTgaGGTGGACATTCTTCTTGGTCGGCTTTGCGCGCTGGTTgCCTGTCTTC
TTCTCCGTCTGCACAAGGACCTGACTATGTCGCGAGCACCAGCATCAGGTTCTAACTCATGATCACGGTGGTCCAACagCACGCACCGTGTCTCCTGCTT
cTTGAGAGACTTGAACTGGGTGTTCTTCTTCCCCGCCTTTAGCGCTGGCTTCTTAACCTTACTCTTGCCTGCACCCACTGTTTTATAATGCAGCATCCTa
TCAGATCTCCATCACACCCCCTTCCGTATCTCCTGTTGTCCGGCGCACgcgtGCGCACATACCGGCACCCTTCTTGCCCATGTTTCTCGTGGGTTGTTGC
CTTTCATGCCAACGAAAAACAGGTTACGCTCCAGGACCGGTTACACaGCGACAACGGTCCGGTTCAGTATACATATCCACCATCATTCCGTCGCTGTGTC
GgTCGCACATCTATCCGGACGGTATACGCCAACGGCAAAAaGTGtGCAGCGCGCGCATCGTGGAAACCCCCAACCAAGCGAGAGAGCACCATGGCGGCGG
CGGACCAGAGCATCGCGATGATGGACGGCACCTACTTCGTAGGTCGCAAGGAGATCCTGGACTGGGTTAACGGCGTCTGCCAGACCAGCCTCACCAAGGT
GGAGCAGACGTGCACAGGAGCCATCGCGTGCATGATCCTCGACTCGATCTACCCCGGCAAGGTGCCCATGTCCAAGGTGGACTGGAGCGCTAAGGTCGAC
TACGAGTACGTGCAGAACTACAAGGTCTTGCAGAAGTGTTTCACGATGCTCAAGATCGATCGCCACATTGAAGTCGACCGACTGATCCGAGGCAAGTACC
AGGACAACCTCGAGTTCATGCAGTGGTTCAAGCGATTCTATGAGCTGAATGCGTCGGGTGCACCGTACGATGCGATTTCGATTCGAGAGAAGGGCAAGGG
TGGCGCACAGTACACGGCCAAGTTCGGTGTCGGTGGTGCCTCAGCGCCTTCGCCGACGACGGgCGCTTCGGCGGCTGCTCGTCGAAAGCCAGTGTCGGCG
CCTTCAGCTGCTTCGCGTGTtGGCACGAaGTCAgCCGGAACcAaGCCACCAGGAGCTCCTGTTGGAGTGACTAGAACGGCGGCTGGTGCCAGTGCTGCTC
GTGCTGGTGCGGCATCGCCGAACCTTCAACAGGCCAAGGAGATCCTCGACCTCACGCACGATAACGAGCGTCTTACAAACGAaGTCGGTGAGCTCAATGC
TAtGGTACGATGATATGTGAGCACaCTAAAGCAGGATGAAgaCACGaTTacTGACGCTTTATGCAATTCTAGGTGgAGGGCCTTGCACGAGAACGAGACT
TTTATTTCCAGAAGCTGCGTCAGATCGAGgAGACCCTGCAGACTGTGCCCGACGCCGAGACGAACGAGCTCGTGAAGGGCCTGTTCGAGATCCTGTATGC
TGCGGACGAGACGGCCGAAGGTGCAGCGGAGCCAATCGACGAGGAGATGTAAATTGTCTCATCGGCGGTCAGCGACAGCTTtCGTTCTTGAGCGCAGCGA
CTGCCTCCCACCTCATACAGGCAGACACCAGTTATAAGtcTATTGCGCGCGTCGCATCTATTACAGCCAAATACAATCAACCGCCGCACTTGCGATCGCC
CCACGAGAACGCCCCGTCCCCATGACTCCATTCCTTCCTCTTCGAAATGTTGTTTGATGTCACTCAAACGCGGTGTCAGATGGCACACTTTCGAAGTGTC
ACTCATAACCACTTCAACATCCCGAAACGaCACCAAGCAGCcAGCAGTCGCCATCCTCATCCGCCCACgACAATGCCACGTAGCGAGAGCAAGAGCTCGC
GcGACGACGAGGACGCAGACGAGAaGgACGCcAAGGGCCGTAGAGACGGAGGAGACGACGAcGACGGCAGCGCGCTGATCAAGAAaGTCATCtCCTaCTt
CTTCGACGACGACccGTtCGCACACACGTTTGAGCGCTTTGCGGAAGAGCATTGCGCCATTTtCGACCTGAAAGCGATGAGATGAAGCTTGAGTGAGCTG
CATCGGGCTGCCGTGTGGTAGATGCCGAAGTGGTGTAACTGTTGATGGTTGTGGCTCGTAGGTACACGGAGATCTACAACCAGTTTCAGGAGCTCTTCGA
GAGCAAGATCGAAGGTGCGATTGCCctGCTATGCACGTGGAATTCACGAACAACGCTGATCAGGACGCTGTGGTGAGTAGATTTCATCCGGTCGCaaggC
GCGAGCGTGCAGCAGTTTTACCAGCACGTTCGTGACGCGTACGagCGCGACCGCGAGTCGAGTCTCGTGcTGTGTTCGGAGATCCTTGTAGCGACGGCCG
ACTTTGACGTTTTTGTGCTCATGATGAAGCAAACAAACGAGTCCATGCGCCTTGCCAAGCACGCACGCTAAGAGCCACTCAGCTgaTGACAGTAGAGTCT
TATCAGCGCGATGCCGCCGTCTTCTTGCGGAGGCGCTCGACCAAGGACGGAAGCTTCACCTTGGGCGCTTTCTTCTTGTCGGAGGGTGTAGACCACGTGA
TGGTAGCTGGAGCGGATGTGTGTGAGCTTGTGCCTACCGGTTGAATAaTACTAGCGTGTCCCTGTGGATTTGcGCTCtttGAAAGCAGcTtCTTGACGCG
ATACGCAGGGTCCTTCtGTCGCTGTCTCTCTTCAAGTGCTTGTTGTCGCTTCTGGGTCTTCTTCCGCATTTTATTCCACAGCACAGCTGCCAAGTTCCcA
CCCTCTCCATTACGGTGGGCGTATGAGAGGTCAGCTGGCACGTGTTGCTGTCGTTGGCTTGTTGGATACGCCACCACATCTCCAATCAGCTCGTCCTCAT
CCCCTTCTACACGGCTATCTTCCCtATCATCATTCATCTCTTCTTCACTTGCGCAGTTCGTctGAACTacTTGTGGTCGGACACATATCACTGTTATGTC
CGGTCGTTCCCAGTCGTCGTCGAGCTCTGGTGGCT