Description :
From Genome Similarity Track
Location :
Scaffold_22:26203- 29404
Transcript NameFunction/comments
Albla_Nc14026020conserved hypothetical protein
Albla_Nc14026030
Albla_Nc14026040
Albla_Nc14026050
Albla_Nc14026060

Sequence
3201 bases(100 bases per row)
CAGCTACCACGCAAAGCATTCGCCTCTTGCAGGCTGCGTCCCCACCGCTTGGCTGAAATTTAGTTTGGTATCTTTTCGTTGGGCAGTCTATGCCTGTTAT
TAGCACACGTAACATATTCATTTATACAATGCTTCCTATCCTTCGATCGTATTCCAAATTCTTTCATCTAAAGCACACTTTCGCATCCAATTTTACGAGC
CAGAAAGCAATGAGCGGAAAAACGTGTACTAGTAATGCAAGAGAGACGGCTACATTTGCGGCAGGATGCTTTTGGGGCGTTGAATTAGCTTTTCAGCGCA
CAGATGGTGTCCTTCAAACAACCGTTGGGTATACGAATGGAGCCGTTGAGAATCCGACCTACCGACAAGTCTGCACGGGGCAAACCGGCCACGCAGAAGC
TGTTCGTGTTGAATTTGATATATCTGCTGTTCAGTACCCAGATCTACTAAAAGTGTTTTGGAACATTCACGATCCTACCACGTTGAATCAGCAAAAGAAC
GATATGGGCACACAGTATCGCTCTGGAATCTATTATCATACCGAAGAACAAAGAAAGCAAGCGCTTTTGTCCAAGGAAGAATATGGAAAGACTTTAACAA
AGCCGATTGTGACGGAGATTGAAGAGGCAAGTACCTTTTGGCCAGCTGAAGCGGAACATCAGCGCTACTTGGAAAAAGGAGGTCAATGTGCGGATAAAGG
TTGTGGAATTCCTATCCGTTGTTATGGATGATCTACCAACATGTTTATGATAATCTCAATGAAGCACTTTGTACGTTTGATACATGCTCCTTTTGTATTG
AGCTACAAAAATCATGCCCTAAAACCGTGGATACCTTTTCTATCGTGTGTAGAGTCTTGTATTTTGTGGTTGCGCATAAGATGTACTAGGCTCAGTCCAA
GCTGCCTATATTACTCGAATTAGGTGGAAAAGACTTCTCTAAATGCCTAAGCTACAGTATAAATAACATAAACACATGCTGGGGTGAAGCTGAGCAATCC
TACTACAAGCTGAACAATGGGGAACACCCCAAGTCAAGGAGACAGGCCACGTAATGTGGAAGCACGCCCGTTACCTTCGTCGAATCTGAAGTAGATGAGG
TCGAATAGCAAAATAGCGCCCTGCGGAGCCAGAAGTAGAAAGAGTCTTCAAAATCGTCTCCAGTTGCTCAAGCTGTTCGGTGTCATAACACTGCCTCTGA
AAAAATCGGCTATGGGCGCTGAGAGTGCTATATATCACCGAAATTGCTGGAGCAGTAGGTGTTGAGGCGCAGTGGTCGAAACGTCTTCGGTTCCGATCCG
TCCAGATAAAATGAAGCGCGACAGCGACCAAAGTAAACCATAGATCCTCAACCCCCGAGTGGAAAGGTTTCCACGCAGTACGAAGGGTAGGCAGTCGAGC
ACACGAGACGTAAGACCAACTTGGTCGAACCGAAAAGAAAGGTGTCCAAGACGGAAAGAGCTCGTTCCAAATCGGACGTGTCCTGCTGCAGTCGAAAAAT
AGGTGCTGATAACTTTCAACACCACCACAATGGTTCTGAGTGCACAGTATGATATCCGGGTTGGCTTGTCGTAAGAACCAAAACCGTGCTCGAACAGGTA
ATATGCAGAACGATAAGCGGAATTGAATGTCCGAATGAATCGGATGCAAGCGTCTTCGAAGACGGTTAAAAAGCTTGCAAAAGTCCGTCCCCCAAATTAT
GGCTCCACCGCGATCACGTTCGGCCACGTAAAGCAGCAACGGGTGCGGCTTGTCCGGCTATGGCCTTCCCAACAGATCGAAAAAGTTGAATCCTTGGGAT
GTTCGGAAAAAATGGCTTATCTGAGAGTTGGATACCAAAAGAAGATTAATGAGGGCGCGGCGGGGGCCGGTCTGAACACAGCAGTAGGCCTTCCGGCTGG
ACCCGTCAAAGAATTTGCGTTGCTTCGATGTACAAACGAAGTAAAAAATTCGACGTGGACGGATCCGACGGAATGCCAACTGCTCTTGTACTGAAACGCA
AGATAAACTATAGAGCCGAGTCAAACCAGGCCGTGCGGCCACCGAACACGTCATGCAAAGACCGGATGCGGAATGCTTGAAGCAAAATCATTCGAAAACT
TCGCCCGTGTTCGGGTACCATTCCCAAACAGCGACGGTGAGCGGAAGCACTTGTCAATCTTCGCTTCCGCTCAAAGTGGAGCTGAGGGTTGATAGGGAAC
CATACGGGAGTGTCCAACAGGTGGTGAAAACGCTCCTGTGGAGACAAAGCATTGATGGTGATATCCCATGTACTGTGATGCCACCAGACACATGTCTGCT
TCCACCACGGAGACGCCACCCACTATAGGACCATGTTAGAATGCCGACGTGGTGATGTAGTAAAAATATCAAGTGCTTGGTAAGGTCCAAAGTCGGGTAA
AACACATTGCAAGATTTGTATACCAGGTGAAGTCCAGTTGTGCTGAGAAGATGAGCTCGACTGAGCTGCAAATTGCTGGAGAAATTGGAGACGTTGCTTC
TTCAGGCTCGATTCGAGCAAAAGAACTTGTAAACCTCCTCCCGACTGAGGTAGGTATAATAATTTCGACTTGATAAGCTGGATGTGCATGGAATCCCGCT
CGTACTTTCGACTCAGAACAAATCGATTGAGCATCGCTTGCCAGCGCCGAAGGATATGTTGCGGGATGCTGCAATGAGTTGTAAAATGCCATAAGCGGGA
TAAGACCATAGTCTGTGCCACCAAAAGTCGGCCACGCACTGTACGTGCAAGACGAAAGCAGTGCCGGAAACCACTATAGAAACGATCCTCTAGGAATTTA
ATCATCTCCTCACCTACTGGTGACTTAATAAATGGAATGCCTAGGTACTTCGCCGACTCGGTTGGGAAGAGAACTCTCACTTTATCAAATGGTGGGCACA
CCTGGTGACGGTACAGTGCAAGCATAGTTGACTTGGATAGATTCAACTTCACCCCTAAGCCATCAAAGTAATGCTGAACAATCTCGAGCTGTGCTGCCAC
CCCACCGAGTGAAGAGGATAACAGCCTTGAGTCGTCCGCAAAAAATAAACTGGTAGCTGTATCACAGGGAGTGATACATATACCCGGTCCTTTGTTCCTT
CACAATAAATTACCCAAAGGCTTAATCGTCATGAGAAAGAGCAGTGCAGAGAGGGGATCACCTTGTTTCGCCCCTTGGGGAGGGACTTATTGTCGGTGAA
A