Description :
From Genome Similarity Track
Location :
Scaffold_901:262- 1399
Transcript NameFunction/comments
Phyci_138101Hypothetical protein
Phyci_135625Hypothetical protein

Sequence
1137 bases(100 bases per row)
ACTACCAGCCTCATTAGTCCATCACGATCCGACTCGGATCTCTTCGTAGGGGGGCAGTAGAACAGCAGATCGCTCAGATCCACATCATAATTCATCGCGA
CATTACCGTAGGATCTGGCCTCTTCAGGCGTCAAATCTTGCACCGAGCCCATCAGGAACTTCTTGAGACCCCATATCCACGCCTCCTCATCTTGCGCTTG
CCGGATCCGCTCGATCCTCATCTCTATCACCACTTCTTCCTGAAGAGCGGACGGGGTGGATCTGGGCCTGGATCCAGATCCGGCACCGGACCTGGATCTG
GATCTAgatccagcgttggatctgatggtcacgggcgagatataggcttccgagtcgtcgctttccgcctccgtcaccaagatttcatttagacggttca
gggtgaccagatcctccagatccttcggctcatccatcaggatcccaccttgccgctgcaatgccgcactcgcaaggctatcagcgctgctgttccagtc
gcgtttgacatgtaccagctcatgatgtggtcagatccgcagtcgatccaacgccttctgtctcaacaacgtaagccccggcgccttgcagtcgatctct
cctcgcacgtggcggatcaccaaattcgagtccccacaaatcactagtcttcgcagatcctccccttccagcagatccatgcatagtactcaaccatgat
attccgcctcgttaacggtcagtccttcggcgtagccggatcgtgccctcacaatattccactcaggtaatttccacaaaatcgcgctgtaggcacctcc
accacgcttgacgcgcgcagatccatcgaaactggcgacaaagagctcttcgtctggcttaacggtcgggatcggcacttggatctggcgtttaggctca
ttcttaggtgcgatcgcaattaacgcccgatccacctcagacctgggagtgatactggctgtcatcgcgcccaggatctcgtcttcacctttgcttcact
tcacagtttcgagtgtccgcgggggcaacaaggcggcccactgcccaaggcgaccttgtaaacctggcgacacgccagcgtagagtgtcttgttagaacc
cggatcTGGCGCCCCACCAGCAGGTTGTGCGCGCCCA