Description :
From Genome Similarity Track
Location :
Scaffold_20:26192- 28072
Transcript NameFunction/comments
Physo_132237hypothetical protein

Sequence
1880 bases(100 bases per row)
CCTCAATCACCCCTTTCACTTCATGTTTTGTCAAATTCCACCACATCTATAACCCTCCTGAACCGTCTCATATCACCCCAATCGCGCCCCCACTCCCTTT
ACTGCTCCGTTTTACCGGATACTGTGGGCTCCGTGCACCGAGATGCCTGGCCAGATGATAGTTGCGGAGCCACAATCCGCTCGACTATTCCGGCATTCCT
GCGGCATTGGCGTCACTCTCGCTCTACGTGGACGCGCAGCTCCGCGTACTCCTTGGCAGCATGACTGACGGCAGCTCCGCAGCCACCGCGGCTGGGCGCT
CCACGAACCTCTGGATCCGCGGCATCCTGGCGCTGCTGCTGGCCACGGGGCTGCTGGCGCTGGCGCTGGAGGCCTCGACGCTCGACTTCCAGCCCAAGCT
GCGGCGCGTGGCGCAGACCAGCAACACGCAGCAGTTGATACAGCGTCGGCGGCCGCACCCGGGCTCCGGCAGCAGCTATGGCCAATCGCAGGACGCGACC
GTCTCGCTGGAGGAGCTGCTGCAGCTGCAAAACGCCTCGAGAGCCAACGCCAGCGACGAGGTGGCGCCCGACGACCTGTTCCACTTGAGTCTGCTGCACG
GCGCGTGCATCACGCACAAGGACGCCATCGTCACGTGGGAGTTCGGCGCCCCCGGGCCGCACCAGGACGACGAGGAGCACAACTTGGCCACGTTGATCCA
CGAGGACGACCCGGACCTGCTGCACATACTCAAGCAGTGCCCCGACGTGGACTTGTTCTTGCCTTCTGGAGTGAGGAACAACGGGTACTGCGAGGATACC
ATGGCGTACACCAAGTACTTGAGGACGAGGCTGCTGCCGCTGTGGGCGCTGACCAAGGAGATCTACGACCCGGAGCTGGGACGCAAGGTGGACTACTTTG
ATCTGTGTCCGAACACAGCGATGCTCTTCTTCCAGCACTACTGGGGGGACATCCCGTCGTCCCCGCGATGGCCCAAGAACAAGAAGATGTACCTGATGCC
GAACATCGAGATGTGGGAACTCGACGAGAACCACTTCTGGCGCGTGGACATCGTGCTGTGCAAGACGCGGATCTGCGAGGACCGAGTAACCAAGTGGTAC
GAGCAGAAGGGCAACCCGCGCGAAACGAAGGTGGTCTATACCAAGCATACGTCGTCTGACCAGGCCAGCTACGCACGACGCGTTTTAGGGAATGAAGTTA
AGCCCAAGAACTTCAGCGATGTGCGATTTATCCACACGGCCGGCGGCAGCTACTGGAAGGGGACAAGGCAGGTGATCGAGTGCTGGTTGTCGCGACCAAA
CTTCCCGCCGCTAGATCTGTATATCCACAAGTGGGCGTACGACGGCATATTCAAGGGCGCGTATGAGAAGCGCATTGCCAAGAGTCAGATCCGACTCACG
ACGGATGAAGTGGATGCCAACACCTTCACCAAGGCCATCGCAGAAAGCTCCTACTTCCTGTGTCCCAGTCAGATGGAGGGTTACGGTCACTACATGAACC
AGGCGCGAGCTTCAGGCGGTGTTATCATCACTACAGACATGGATCCGATGAAGGAGCTCATCCAGAACGACGACATGGGGCTCAGGGTGAAGGCGAGAGC
TGGTCACGACCGCAACATCTTCTTGGGTGGCAAAAGCAAGAAGCGCAATGGACTCCGTGATGTCCCCGGCATGGTGGCGTACTTCAGCTCCAGAGACTTG
TGCAAGACGGTGGAGCACCTGCTCAACGATATCGACATGGACAAGCGAAGAGAAATGGGCGAGAATGCTCGGCGGCAGTACCACGAGGACACCAAGTTCT
TCGAGCACGCGATGCTTAAACTGCGCGTCCGCGCGAGGCAAGATGCCAAAGCAATTAGCCTAATTGACCCCGAAGACGAC