Description :
From Genome Similarity Track
Location :
Scaffold_745:2619- 5878
Sequence
3259 bases(100 bases per row)
TTGAGGATTGCACTTGATCAACACCTTCAATACTTGCATGCAAATCAGAAGAAAATTGCACATGTGCAAAAGTTAAAAGATCAGGAAATGAACACTTAAT
GCACTCAACGAGAACAATACGGAAGAGAATGCAAGCTTATTTCACTGATACTAAAACTGCACGACGGTAAAGAACTTTGCGACCTTCGGAAAGGTATAGC
CATACTTCTAGCAGCTCACTACCGCAAGAAACAGTCGATTATCCTCGAAGTAGTAATTTTAGTGAAAGTTCTCAACGTCTTGAATGCAAATCAGCTGCAC
CATTTGGGATAAAAACTGCCCCCAACTTGGGACACAGAGAGGCTATCAATGATGTGTCCTAATTGGTGACATAGCGTACAAGTTATTGTAAAAAATGTCT
TACTATACAAAATATGCTCTGTACCCAATCCTGCATAAGTCGATAAATCACCTTTTACAGGAAAGATAAATCAATGGTGCCCAGGAAGCTCTCTGAAGAC
AGACTCATAAAATTCAATCACATCTCTTTTTTCTCCCTTCTACTCAAGCTCCTCCACCTTCCTCGCCTCACCCTCAATATATATCGATCCTCCAAAGTGC
CAATTACGGTCTCGGTAGACGCGGCTGATGGCCTGCTCCCGCGTCAACTCTCGCATGATTCCGCCACCAATGAACTCTTCTCGAATGAGATTCCAAATCT
GCGAGGGGGGCGCGGAAATCTGTGGGATGGACCAAAATGTTGGTCTTCTCAGCCCTTTTCCTGACTTATATNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTTAGATGCGATGCAAATGCTAAAGTGAGATTTACAGTTAAGCTCCTACCCACGAA
CTCTGCCAGTGCAGCTCCTGCTGCTCTCCTTGTGTCGCGGCAGGGTTGCAGTTCAATACTGCAACTTCATGTAAGGTTGTGGTTGTCGTCTTGATTCTGG
ATAGCCTTGTTTCAGTCCAAGATGTAACTTACGCAGTGCTTCAGACTACACTGCCCCCGAAGACGACATCCATGTCCATAATGCAAATATAGAAAAGTGA
CAAAACGTGTCACTCATGATGAATCATCATGACTAATGATCACTCATGATCATGTCACCCCATAGACGATCCAAATGTGAGACGGGCGGGTGTTACTGGT
TATGTTGCACTTTAACTAGTTGAAGTTATTGCTCCAAAGCGTCGCACGGTCCCGTTAGTTACTGGCAGCTGTAGCCAATGAAGAATCGGCTCGTTGACGT
GCATGGTCACCACTAGACGTCACATATAGCGCCACATGCGAAGGAACATCTTTTTGAAGTGAAGCCATCATTTCCCACGAGTTTTTTTTCTTGCTGTAGA
CCTTCCCACGATACCAAGAACTGCCAAACACCATTGTCTTTTCGGTGGTTTAAAATGGCTTCCACGCCAAGAACCATCCCTTGGTTGCCAACATGAGCCA
AACGTTCTGTGTCGATGTTGAGGCTAGAGTCGACATAAAACTTGAGACGCGAGCCATGCACGATGTAACGCTTGTTCGTCACTAAGTGCCTAATTTTGAA
CGAATGTGGAGCTGTCTCCACAACTTCGAACGGGCCAGCCCATCTAGCCAGCAACTTGTTCACTGATAAACGTGAGTCAATACGTGACCAGAGGACAAAA
TCTTCGATAGTGAAGCTGCACCCTGTCCCTTTGGACCGAGCCATATTCTGGAGTCGACGTTTCTCGCGCTGATCCATAAACTCTCGGTGCATTTCAGCTA
GGCTGGCACGAAGCCTGTCTAGCTGTTGATCTTGCATTTCATTGGCATCCGGTAGGATCTCGAGGTTTTGATCTCTCTCTATCAGGATTGACTCGAAAGG
GGTTGGTCGTGGTATCCACGTCAGGTGTTCGCTGGGGGCGTTACCTCCCAGCGATCGTACAGGTGTGAGGTTGATGTTTTCTTGAGGTAGCGGCAGCAGG
TACACCCACTCATGCGTGTCCAGTTTAAATTTCATAAGTAGAGCACGTAGAACTTGCAGTACGTCGCGGCTCCGACGCTCTTCTGTTCCGTTTATCCATG
ATGCATATGCGACTTCCAAACTCTGGTTGACGCCAAGCTTTTTTGCAAACTCGACTGATCACCTCATTTTTAAAGAGGCTGCCCTGATCCGATATCAGTA
CAGTTGGTGCACCGAAACGTTTCCACCAATCCACTAGAGCACACGCCGCCACTGTACTTGTAGGTGAATCGCACGCCACTAGCTCACAAAAGTGCGTCAA
ACCATCCTTAAGTACCAGTACATATCGACTCGAGCCCATGCTATCGCCCATGTAGAGAAAATCAACGTACAACAGCTCATTCCGCTCCTTGGCGTCGTAC
GTAGGTCCCCACGGGCGAGGTATAATATTCCCTCCTTTCACATGCTTGCAGAGAAGGCATCGGCTAAGAAAACGGCGACACAACTGTGCCAAATTGCCGA
TCTCAAATAGCACTGTCACGGTAGTGATCATTGGCTCAATGCCCCTATGTCCTTGCACGCCACAGTGTGCTACAATCAGGATACGTTGCAGAAGGGCCGG
TTCAGTTCCCGGTACCCAGAAGCGATCGTTAGCCAGTATAGTACCCTCATCGTCGTGGCACGCGAAGGCTGGTGCGAGACTTGCGTGTTTTGCCTGAGCC
TTGATCTCGCTGAGTGTCTGGCAAACAAATCCTTCTGCTCGTTGGTGTAAACGCAGCATGTCTTCATTTACTGTTGAGACTTCTCTCTGTTGACTGCGCG
TGGTGACCACCTTGCATTTGGCCACACCACCTTCCCCACTCGATGGAAGCCCCCATCGCGATAGCAAGTCAGCCCACATGTTGACTGACACGTCAATGTG
TTCGATTTGATACGGTAGTCCAGTCAACGAAAGTACCCAGCGCTGCAATTTGCCACGCA