Description :
From Genome Similarity Track
Location :
Scaffold_1675:2619- 5478
Transcript NameFunction/comments
Phypl_g13938vacuolar protein sorting-associated protein 35, putative

Sequence
2859 bases(100 bases per row)
CCACTTACCCAAAAGAGATGCGCGCAGTTCAGCACCATCAAAGCctgctcgttcttcttgagcagccgAGCAGCGTACTGTGTGGTCTTGGTGGCGAGAA
CTTCGTAGTTGGCGCTCGAGAGGTTGCGGGTGGCACGAAGGGATGCTACCATCAGCTCTAAGGCACGCCACTGTTCACGTGCAAGCGTGATTTGGTCTTC
GTACACTATGAATGCCTGCGTGATGAACTCGTACGCAACTGCCTCGAAGGCGCAGCCATCAGCCACCAAGGCACACTGTAAAAACAAGTGGACGCACGAT
ACTGacagcgcgtcctgcttAGAAGCAAGCGCCGTCACCATTTCGTGTACGAATTGAAGAACTTCACGAGGCGTTGTAACAAAAGTCTTGGCGTTCCCAG
CAAGTGCTGCGGTCTCTGACTCAGCCTTGGTCTCTTGTCCTTGAGTTTGTGTCTTCTCCTGGGAATGCGCTGCTAGGTCTCTCGCGAGTGCCAGCGACTG
GTAAATTAACGGCACGAGTGTGAAACGAATCCGGAAAACGCCACTCTGCAGAAATGCACGCCGCGCCACGGAAAACACGCGAAACTTGACGTCGAGGTCG
TCGTTCGTTacgaggtggacgacctTGGCCAGCGTTTGCTGCTCAGCTTCAAAAATCTCAGCTTCCTTACTCTTTCCAGCTTcagttgctgtcgctgggg
gTGGTGACTGTAACTCGTTGGGGTCGTCACGCACCAATGGTGCCAGCACCTGCAACAAGAAATCCATTTGCTCCTCATCGTGGACACGCTCATGctgagc
aagaagcacaCGGATCCATGCCAGCGCCACATCCTTCCACGCGCCTTGCCACGGCATCAATGCGAGCAATTCACGCAGCGCCGGAACTTGCATGAGATCT
TGGATGGGAAGCGCTCGAAGGAGCGTAAGCGCGAGGGATTCAAGCTGCGAAACCACGAGTTGGCGCGTATGCTTATCTTTGTCAATGCGCCACGCCGTTC
GCTCACGTAGAAACGTTAAGCATCCAGAAACTACCTGCTGGAGGGCTGCCGTTGTGTCTGCGTTCCTGCACTTGGTACTACGACCCAACCACGCGAGGGT
GAAAGTGGCAAATGTCACGAAAAGGGGCAACACAAAAGCCAAGTGTACGTCCGCACCGCCACCTTCACTTGGAGGTTCACCACTTCCAGCAACGTATCGT
GACGAgcgcaacagcagcttcgaagTCGTAGCCATCAGTTGCTGGAAAACCCGGAGTCcctcttgctgctcctgtTCAAGTTTGGTAGGGCCGTCCACCC
CCGCTTCTTGCTGTCCCGCGTTGGTGACACTGCCCTGAGCCTCCCGAAACTTAGTGAGGCGCTCCAGAAGTGCCGTCAAGATCAACGCGACGTCAACATT
TGTCTGCAGTTTTTCCATTGCATCCAGCAGTCTCTCAAGGTTTTGCAAGTGGAATTCGTCCGGGAAAACCTGGATGATGCAGTCCATCAGGTACTGCTGT
GCCATGGAGTCTTTGCAGGcaagcacgacgtcgtccagtaGCCGAGGCAGCGCCTGCTCAGCGTAGACGCTGCGCGTGACTCCCTCCATCTGACTGAGCC
GCACGAGGCTCGTTCCGACCAGCAGTCGCAGCTCCATCCGCTCTTTTTCCCGAACAGCCAGCGGTCTAGACTCTCCAATCttttggtgctgcaggcggaT
CCAAAGTTGGTTGGTCTCCCGCaggttctgcagcagaaaATCGATAGCGTCGCTGACGGAGCCCCCGCCCGATTGCTCGTACACGGAGCCCGTGTCCGGC
AGCTTATCACGGACGCTAAGCGACAGATAGTGCCTCAAAAAGAGCCCCCGCAGCGGGTACTGGACGCCTTTCGTCATCTCCACGAGGTCCGTCAGCACGT
CTCGAGCTGGGGCCTCCCGCGACTTGATGTACACCGAGCCCACGGTCACCAGCAagtagctgcagcagcaaaacaGCACACCACAGCAACAAAAGACGTC
ATTAAAAGCCACTACAGTATAATACTTTGCTCCAATTGCAGCCCGTACAGCCTcggcagcacgttgccgctgctctgGACGCGCTCGTAGAGCACGCGCA
TGGAGGCGCCcgcctgttgctgctcctccacgTAGCTCTCGAAGTGGCGCAGTTCGTCCATCACCTGCATGTCTGCGGCATCGCAGCACAAAGGTCAGTA
GATGAGCTCCTAACGGCACGGAAGCAAGAAGCGCTACACTACAGAGCTGGTAGTAGTTCTTGGGGGACAGCAGActcgtgcgcagctcgcgcagcacctc
ggccgcGTGGTTGAGCACGGCCGGCTGGTCGCCCGCGTCCGCGGCGCGCTGCATGCGGAAGCCCTGGTCGCGCACGGTCTGAAGCGCCTCGCACAGCagg
tcctcctcgccctgctcgtccagcacgaagcctCCCATGTCGAAAGATATATTTCTCTCTTCGAGAAGCTATTTAGGCGGACGTGTTTCAGAAATTTGGA
AGAGCTAGATGCGCTGGAAATTACAGCGCATCTGTGTACCGGTAATGCCGTCGCGTCAAGCTGATTTTAGTCCGCCCTCTGTCGACGTGCAGGGGTGACC
CCATCGCAGCGGGTCTTCCTCTCTCTCAGAGAAGAGAGAAGTTCTCTCTGCGGGCGATGGAGGAACAGCAGGGGCTCGGCTCGTCGTCAAAACAGACGCC
GCCTCGCCGATGTGCAGGGTAGGACGCCGGCGGCATGCTGGTGGTGAAAGTCAACGCCCGGGCCCcatgaagaaggccaagcgaGCATGTCGAGAGTCGA
AGGCCCCGTTGACACGAGTGGGCAACCAGCGCTCGCATCACTTAGTCCATGGCTGCAGG