Description :
From Genome Similarity Track
Location :
Scaffold_92:261803- 268273
Transcript NameFunction/comments
Physo_140995hypothetical protein
Physo_140996reverse transcriptase

Sequence
6470 bases(100 bases per row)
TCCCGGAGCTGAAGGAGTTCTCGGGACGAGATGCCGGTGAAGAGAAGGCTAGGCTGTGGCTCAATCGTCTGAAGTCCGCTGCGCGTCGCGACGGGATGAC
CGGTGAGGAAGTGTGCGGGCTGTTCAGCGATCTGATGAGCGGCCCTGCACGCCAATGGTATCTCCAGTTGCCCAAGAAGGTCAAGAAATCATGGACCGAG
CAGATGGAGCAATTCCGCGTTCAGTACTGCGGCAAGGGTGTGTCAATGGCCAGCCGCTACTACCACGCGGCTCAACGCCCCGATGAGACTCCGCTGGATT
ACTTGTACCGACTCAATGTCGCAGGCTTGAGGACCAACATCCCATACGCCGAGGGTACGACTGAAGAGAAGCGCGAACACGTCGAGCATTTTATCCGGAC
GCTGAACACACAAGAGGCTGAACTTGCCTCGCGTCTCACGCTGATGGAGGTCGCCGACTCCGAGGCGCTAGAGAAGAAGCTGCGTGCCCGACAACGGGGA
CTGGCCCACCAGAAAAAGACTCTCTTCGGCTCGAACAAGTTCCGCCAAAAGGCGCCGACCCCGCCGACTCAGCCGGCGCGCGCCGTGCATGGGATTCACG
TCGCGCCGGACGAGTACGACTCGGAACGCGAAAGTCGCGACAGCGACGATCGCCAGTACGACCAAGACGAGGGGGACGAAGAACGCGCCAAGTTGTTCGT
CGCGGGGCAGGCCCCGCCGGGAGAGCCGGCGAGTCGCAACTTCGACCCCGATGACGCGGGACGCGACCGCCCGCGGTGCCGCCACTGTGGTTCACGTCGC
CATGCCGAAGGAGACTGCTAGAAGTTGTTGACGTGTCAGAAGTGTGGTGGCCAGCACCCGACGGAGCGATGCTTGAGGGTGTGCAAGGCCTGCGGTGACG
TGCACGAAGCCGGGGAATGTCCGATGGAGGAGTTCTTCAACCAATTGCGCCAGTGGTTTGATCCGAATAAACACGCAGGAATGCTGCCGCCGGCCGCCGA
GAAGATGTTAAACTAGGACGCTCGCTGGCTTGGAAACCAGTACGAGACGAGCGACCTGTTTCCGTCTATGCATATGTGACCAAGATGTCGCGAGAAGTGG
TCTGTGAGAGCCCGACTTCCCTGAATGATAATACATGTGAATCCAACCTGGAACGTACCACGCGGGGACGCGCGCCGTGAATCTCAGCGGTCCGACGTAC
GACAGACGACGAGTTTGCGCGTGAACCACCTCTGGACGAGATCGACTTGCAACCAGGAGAGCGACGCGGATACTGGAAACATTACGCGCCGCACAAGTGG
TATAAGCAGGCCAAGATTCATGGAAAGCTGAACAACCGCCGTGCTGTGTTATTGCTCGACACAGGTGCCGAGGTGTCCATCCTGGACACCACCTTTGCTC
GTGAGGTAGGCTGCCTGGTTGACACGGAGATCACGCAAGAGTGTGTGGGAATTCGTGATGAGACATATTACACGGTGGGGAGAACCAGAGTCAAGATTAC
CTTGGCTGGGAACTTGGTGTACTACATGCACCTGTGGGTCGGCGACTTGGTCGGCCAACACGCAATCCTGGGAATGAACTTCATGGTGGCCGCTGGAGTG
CGCATCGACACTGCGGACGGCACGGCGTGCCTCCCCGACGAGGTGCATATCCAGATGATCGGACGAAGACCGCTATACGGCGCCCGGATGCACCCGGTCA
ACGTCAAGACGCCTGTGAGACTAGAACCAGGAGACACGCATGAAGTCTTGCTGAGGCCGGATGGAAACGCGCCGTTCCTGTGGGTGACACGGGCAGAGTC
GTGGGTGACTACCTTTGTCAAAGGAAGAGTCGGAAGGAAGACGTACCTACGTGTCACGAACATCGGAGACGCAACGATAACCCTCGACGCGCATGAAACG
CTTGGGTGGTGGACGCCGTCTGACGGCCAGCCTCGGAACCGTGGATTCGTCCGACGGGGCTCCACCCGATACCAGCAGTGGCAGAATCTGGCATACGGCG
CGACGTGCGACGCGGAGGAGAACTGGATCCCAGCCGAGCTCGACGGACCGATGACGGATCGCCCCTCATACCCGACGCATAAAGCCATCTTGCGCCCGGA
GCCGAGACAACTCGGGACGCGACGCGCCGTAACCCCAGTGTTGGCGGCTGTCGCGGAAGCGCCGAAGGGAAGGGGGGGTAGACTTGCCGTCCGACGACCA
CAAGCCGGATGCGGGCGAGGAGGCGGTGGAAGGCGAACCCGATGTGCCTCCGACTGTGGCTGGAAGCGCCGCGATGGAGGAATCGCCGGAGTCGGAACTC
GCCGGGCCAAAACTCGACGAGCCAAAACTCGACGGACCAAAAACCGCCGAGCCGAAATTCGACGAGGCGAAACCTGATGAGCAGGAGGAAGACGACGCGG
TCCTCATCCACGACGGGTCCGACCTCTTTGCAGACGATCTCGAGTCTGAGATGGCAGTGCTGCCAGACCTCTCGCTAACCGCAGAGGTGAAGATCGAAGG
CTTGAAGGTCGGCATGCCGACTGGACTCCCGCCCGAGGAAGCCGCGAGACAAGAAACGCGGCTACGCCAAATCATCTGGAAGCGACGGAAGTGGTTGATC
GGCAAAGGCAACGCCTTACCGCCAGCCGCCTTGGGGGTTGTCTGCGACATCGACGTGGGCGACGCAAAACCCGTCGCGCAACGCGTCCGGAAAATCCCGC
CGCAGTTTCGAGAAAAGATCGCCCACTTGATCAAGGGGCTGCTGAGCGCGAGGATGATCCAGAAGTCGAAGTCGCCGTGAGCGTCGCCAATTGTCGTGAT
CATAAAGAAGAACGGCGTCGATATCTGGCTTTGCATTGACTACAGGCTCATCAACGGGCTGACACAGTTGATGATTTACCCCATGCCGCTCGTCAACGAC
TTGCTCGAAGACTTGGACAAGTATCTGTGGTACTGCTCCCTCGACATGGCAAGCGGCTTCTGGGTCGTCCCCATGACAGACCGGGCCCGGCTCATTTCAG
CCTTCATCACGCCGATGGGACTGTACGAATGGCTGCGTATGCCGTTCGGCCTGTGCAACGCGCCGCAGATTTACCAACGCTTGATCGACAACGCGCTCTA
CGGGTTCATGAAGCTGTCCCCGGATGGCAGCACTCGGGACGTCTTTGAAGATGGCGAACCGGTGAAGCCAGGTATTCACTCCGTTCTGGGACGAAGGTCG
TACATCGACGACATCCTCATCGGGGGCACGTCGTGGGACGACCTGTGCGAGAAGGTCAAACGCTTGCTGGATGTCTACGAGCAGTGGCACTTGTCCATCA
GTGTCGAGAAGAGCGAGTGGGGCATGGCCAAGGTCGACTACCTGGACCACCGAGTCTCAGGACTCGGTCTCGAGGCGACGCCAAAGAATCTGGGGTCGCT
GACGTCGCTCGAGTTCCCGCGCACGCTCAAGGGCCTGCAATCGTTCTTGGGTAGCCTCAATTATTACCACCGGTTCATTGCAGACTTTGCGGTGTATGCA
ACTGCGCTGTATTCGCTGACGGAGACCGACTTCAACGAGTACGTCACGCGTACAGACGTCCGCTGACATGAAAAGTGGACGCACGCGACGCGCGCCTTCG
ACGCGCTCAAGTCAAAACTCGCCGAGACCCCAATGTTGAAACACTTCGACGCGAACCGAGAATCCGTTGTGATCGTGTACGCCAGCGACTGGGCCATTTC
AGGGGTGCTCACGCAGACCCACGACTTGGTGTACATGCCCGTGAAGTTCATCAGTCGTACGCTGAAGCACAACGAGCTGAACTACGACATCGTCGAGAAG
GAGATCTTGGCCCTGTTGCGCGTCTTGAACGAGTACTACACGATGCTAGCAGAGAGACCGGTCCGCGTCCTGACACGTCACACGACGCTCGCCTGGTTGT
TCCGGTCCAAGGGACTACAGGGGCGACTGTCACAGTGGGCCGCGATCCTCTCGCCGTGGAAGTTGGAAATCTGCCGATCCATGAAGGGAGAAGAAGAACT
CCTCGGCACGCTGGCCGCGAGCATTGCCCCGTGAGCCTTCGTCGACGCGGCGCTAGAAGAGATCGCACCACGGAGACGGGCGTCCAGGGTTGTAGTCATT
CCAGTCCCCGACGTGGCGCGCGACGAGGTCTTGCACGTCTTGAGCTTCGACGGATCGGCTAAGGCGAAGCGAGAAGGCGGAGCATACAGTGCCGTCATTT
GGCGGCTGCCGAACTGGGAGATCGTGTGCGTCGCGACGGGATATGCGACGAACCTCACGGTCAACAAGGTGGAATACCGCAGGCTACTGCTCGGATGTTC
TCTTCTAGAGGAGCTCGACGACGTCACCCGACTCGTCGTATGCGGAGACTCCAACCTTGTCATCAGGCAGATGCGGGACGAGATGGACTGCAAGTCCCCG
GGGCTGAACCTGCTGCGACAAAAGACGCGAAACGCACTCCAGGCATGGCCGCACCACGAGCGCTTCCACGTACGACGATATTGGAACGCGAGTGCCGACA
TGCTGGCTGGACAAGCTCTGCAGCGTCAAGGAGGCCGCAACACGCACAGTCCCGAGGAGATTCAAGATCTGAAGACGCTGAATGGCTTGGAAGAAGTCAT
CCGACCACGGGCATCGAGTCCCGATAGGGCGTCTTCAGCCAGTCTCGACGCGGATAATCTCGACGCTGATGACCCCGCTGAGGTAGCCATGGACGCGGGA
CGCCGGACAGCACCAGTTTTGCGGTGACGACGCGCTCGGCTGCCGCACGCACGACAACACGTAGGGGCCGACCTCCAGAAGTCCTGGAGGAGCTGGTGGT
GCAACGACTGCGCCTGGACCGCAGCCGCGTCGCCCAGGACGAAGAGGTCTGGATCGCCAACCTCAAGAAGTATCTCCGCGGCGACGTCGGTGACCTATCT
CGGCGCGAGGTGAAGAATTGCCAAAAGCTTGCACCTCAGTACGAAGAGGGCGAAGGCGGGCTGCTCTACTACCAGCCGAGAAACGACGATTCCGCCGAGG
ATCGCAATGTGATGATGAAGCTGGTGATCCCGGAGACTCTTAGGGAGGATATACTCCACCACAATCATGCGAGCCTGGAAGGCGGACACCAGGGTATTGG
CCGCACATACCAGCGCGTGAGGCGCCACTTCCATTGGCCAGGGATCTTCAGAAGCGTCCAGCGCTACGTCGGCGAATGCACAGACTGCGAGACGGGAAAA
GGTCGGCCGACCATCCAGGGCGAGTCGCCGGGCAACATAGTCGCGACGTACCCGTTCCAGGTCATCGCCATGGACCATATTCCGTCGTCGCCGGCATCCT
ACAAAGGCAACACAGAGCTGTTAGTCTGGGTCGATCTCTTCACGGGGTTCGTCGTGGCCAAAGCGAACGCGTCACGAACCGCGCAGACGGTGGCCGAGGC
GTACGAGGAAGCGGTGTTCAGGCGCTTCGGCGCGAGCGAGGCTATCCGCCACGACCGCGAGCCGGGCATCATGTCCGACTTCTTCAAGGCGTTCAGCAAA
CTCATGGGTCAGAGACAGCGAGCGACGCTCGCTTATCGTCCCCAAGCCAACGGTGCTGCAGAACGCATGGTGCAGACGGTTACAAGAGCGATCAAGATGT
ACATTGCGGATGTCGACCAACGCGACTGGAACGAATACGCTGAGCGTCTTACCTTCGCGCTAAACACGTCGTACGACCGGACGAGGAACGAAACCCCGTT
CTTCTTAGTGCACGGCTGGGATCCTCGGTCGACGCTGGAAGCAACGCTGGCCGTCGGGAACACGTCGACCCGGGACGCCGAAGTGAGGCGGTGGAGGCTC
CGTATTCAGCGACACTACAAGGTGGCAAGGGCACAAGCGTTGGAGTTAGTCCGAAAGGCCGTCGAAGAGAGAGAGCGTCGACAGACTGAAAACGCGACGC
AACATGAGATCGCGACGGGCTCGCAAGTTTGGCTGTACCTGGATCGGGTGAAGCCGGGGTATGCGCGCAAGCTTGCGCACATGTGGTACGGACCCTTCCG
CGTCGCCGAGCTGGTCAGCGCGTTCACAGTGCGCCTCGAGACGGCGGGTACGCCCAACCAGCTGTACCCAGTCGTCCACATCTCCAAGCTGAAGCCTGTC
CGGGAATTCTCGTCGCGACCCGCGACGCAGCTGACGGTGCCGGCCAAAGAACGCTTCGACTTCGACGAGGAGCTCTTGGCGGAAGATAGCTGGGAAGCCA
CGCGCGAGCTGGAGGGTGACGTCTTCGAGGTCGAGAAGATCGTGAACGTGCGCGAGGGGCGGGTTACCCGGTATGGGCGCACGCGACGCGAGTTCGAAGT
CAAATGGAAGGGCTACCCGGACACGACATGGGTCGACGAGCTCGATCTGAATTGCGGCGGGTTGTTGTACGACTTCCTGCGCCAGCGCACGGGACGCAAC
CGGTTCGAGGCGATGCAGTCGCACGAGAACGCGGAGGCGGCGGAGCCTGGTGGGTGAGCGCCCACGGGTG