Description :
From Genome Similarity Track
Location :
Scaffold_2186:2618- 4785
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_2186-snap-gene-0.1Gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_2186-snap-gene-0.2Gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_2186-snap-gene-0.3Gene of unknown function
Pytiw_DAOMBR242034snap_masked-piw_contig_2186-abinit-gene-0.7Gene of unknown function

Sequence
2167 bases(100 bases per row)
CAAGATGGCTTTCGGGTCTGTGTACACCGGGCGTTCTACTGCGGGTGGCAGGTTCGAGTTGATCCTTCGGCGCTCCGCTTCCTCGCGGGCGGCGATCCTG
ACGTCCGGTGTAGCCTCGTAAGCCAGCATCTCCCAGTCGCGATACTTCTTGGACCCGATCGATACGAAGCCTGCTCTCCGCGGCAGGTGATTGTTGCTCA
GCCACATCTCGACGACTGTAAGCGAGTCGATCGTGATCGCGACGCTCCCGACATTGGTGATTACCAGAGCTAGCGGTACCCCCACCGGCTCCGATCCTCG
CCGTCGCTACCCACCCTTGGCCGCTCGTCACCCACAATTGGCTTCGATCGGCGATCGTCAGTTGGATCTCCAAGGTGTCTCCTGGTGCCAGCCTCGACAC
GTCAGTTAGAGACATGGATCGCGTCTTCGCATCGAAGATTTGCCGGCGACCGCCAAATCGTCATCTGACCTCACCCGGCAGGCACGCCGATCTGCCTGCC
AGGTCCAAACGCACACCGGCCGGGGTCGTGAAGTCCATGCCGAGGATCGCTTGCATTCCGCTCAGCTTTCTGACCAGCAAGGTGAACTCATACGCTAGCT
CGTTCGCGAGAGTGATCTTCACGCGCGTTTTGCCTTCCGTCTGGTTCACTGCTTCTCCAACGTCCACGCACTGCACCGCCTCAGATGTGTCGACGTCGAT
CCTCGCTTCACGCGCAAAAGCGGGATCGATGATCGACACATCGGCACCGGAATCCAAAAAGATTTCGCCCGAAAATCGTTGATGGCAGCTTGGACAATGG
TTTATCGGAACGTTTGGTTTGGATAGTGCTTCCAGTGCCCTCGTTTCTCGCCCGGAAGTAGCGACAGTCGCTGAATCACCGGCAATCTCTCGAATTCTCA
ACTCACTGCGGCGATCGACCCGACGATCGTAGGTTCGTGATCCAAACGTACGTGCAATTGATCACCATTATTTCTCTCCTCTCTGTCCGATTTCTCCCTT
CTCTCAATGAATGCGTACACGCAGGTGAATGGCCGCTCGCTGCGTTACGACTTCCCAGCCGGCGAGAGTACTAGTTTAACAATTCCACCAGGGTTGGGGA
CAGCATCGCCGAGTGCTCTTCTGGTTTGAACCACTTCCGGAGCTCTCGGACCATCTTGTCCAACCCGCATTCATGGACTTTGCCGCATCCTTTGTAGGTT
TGGAAGAAGCGGTCGATTGGGTGTCCAGGCTTGCCACAGCTCTGGCACGTGAGACGACGCCAGCGGTCAAGATCGCGGTGCCGCTCCACAGCGCGAACAT
GGCGGGTTCAGCTTGCGGTCTACTCGTGGACCATCGATCTTCTCTGGTGCCTTCTTGCTCAACGTCGCAAAGATCTTCAGCAACGCATCAAACTGATCGC
TATTGTCCTCGCAAGTTTGCTGATCCTGACGATCTGAGGGCTCAAACTCGCTAGATCCGCCCATCTAGAACTCGATCTTTGGTAGATCTTGGTCGTTTTC
GCTACTGTCTAAAGACTCCCAGTTGCGGCCACTGCGTCCCGGCAGAGGACCAGTGAATGTCACATGTCGAATCTCTGGCTCACGCTTAATCGGCTTCGGC
TTGGATGGAGTACGCTTGACCTTCTTGCGCGACTGCGACCGACGAATCGACACCAAGGTCTCCTTCAAAGGCACCACATGTGGCAGGCAGATCGACACCA
GTGTCTTGGCGAGATCGTCATCGCGGACAGTGTCGATGAAGTGATTGACGTGCTCCTTAGCCTCCTTACTGCCGAGTACCAAGTACGGGATCTTTGCGCG
AGTCGCTTGGACATTCAGGTGGTGGAGATAGTCGATCGGCCGCTCATGGTCCAATCGGCGCACTTCATAGTACTTGCGGGAACTGGAGATCGGCTCACCG
CAGTACTCAGCCTTAAATGCCGTCATCACAGAGTCCCAGTTCACACGCGTCTTCCGCGACAGTTGACGATACCAGTTCAAAGCCGGTTCGGCGTACAGCT
CAGAAAACGTCAAGCAGGTCTCATCGATCGTCAAATAGTCGCGTCGGAACGCGGGTGCGAGCTCGCGTCAACCAGTTGGACGCTTTGGCCTCTTTATCGC
CTCGTCTGCTGAACTCCTTCAGATCTGCCACCACCAGCGCACGGATGCTGGTTGCGGCGACGGATCC