Description :
From Genome Similarity Track
Location :
Scaffold_32:261785- 267460
Sequence
5675 bases(100 bases per row)
CCCGTTACACCTCGTAGCACTTTGTAGTCCGTCCAACGACTATGGACATGTTGGATGATGAAGCGGAAGACTTCCATCCAACGTACGATAGCTACTCCCA
TTTGAGTCAAATCGAATGGGATGTTGTCGAACGCTTGAGTTCAACGATAGGGCAAGAAGTCGTAGGCGCAATACTTGCCGCTCTGGGCCCAGACGGGCAA
CACGCCACCATCGCCAAGTTCATTCAGAATGAACTTGACGCTGAACGTAGAAAGGTAGCCTTTCCTTACCAACAAGGGTCTCAACAGACAGAGCTTTTGA
GAGAACAGAGTGCTCAACAGTTCGAGTTGTTGAGACAGCAGCTGGCTGCTGCCACCGGGTTGACACACTCACGTCGACCCGAATCACTGGAGATTGACAT
CTCCTGATACAAAGCAGCTGAAGAAGATTCTCTGCTGAGATGTTTTGTTGAGCTAGATGACGCCATAAAGGCTCGCCACATCGTCGATGAGCAAATGCAG
GTCGCATTTCCTCAGTCAAACTTGGCAGGGCGTGCGAAGACTTGGGCCTTGGGCCTCAAGCTACACGAACCATTTGTCTTTGGGTCGTTAGAAGTCTTCA
AGTCCCTGTTCAGGAAAACATTCGAACCGCCACGAGCTGAGTTCAGGGCTCGCTCTGACCTCCTGAGTCTCAAACAAGGCAAACTTGATGTACACTTGTA
CATTCATTACACACGTCATCTTACAGGTTGCATCACGTTCAATCCGCTGAATAAACAAATGTTGATCACGTTGTCCATGCAGGGTCTCACAGACGGCCCA
GTCAGGACTTATCTCTTCCAGTTGGAATTTGGTACCCTGGAAAAGGCAATCCTAGTTGCGGAACAAGAAGATTTCAGCGTGAAAATAGCTCACGTGAGTT
CAAACACCTATCTTCCCCGAGGCGACAGGAAAGCGGAGGCCCAGAACTGATTGACCTCTGTTACGCTGAGAGTGAAAGCTCTCGCACTACCAATTATAAA
AAAATTGCAGACATGCAATAGGTTTCAAAAGCCAGGGCATTATGCATACGAACGCAGTGTCCCGAACGCGGTACCACATACCGCAGGAAACAGTAACCGT
TAAGCGGCCAAGAAAGGCCCGAGGCGTGGTTCCGACGCTGTTGCGAAAACGGAACACCGTAACGGACAACCAAAAAACGGTCAGGGTCAGTAGGTGCGGA
GCACCCTACTGATCTAGCAACGTCAAGTGAATTTGCAGGCCTCTTGACGAGAATTTCTCCCAACACGCAATCATTGTGTGTTACTGTATCTGGTAATGAG
GTTTCCCTCATTACCTTGAAGCTCGAAGTGGCAAAGGACATGCCACTACGATCCCGAGGCAATTGTAGGGCGTCGAAAAACTTTGTATGATGCCAATCGC
TAGACAATATCAAGCTTAAATATATCGAGAAGTATCGCACTTTTGTTGCATTCTTGTACAAGCCAACTCGTGCTCCTAACAGGTGAAGCTGGTACATGAC
CATGTAGCCTGCTTGACGCGAACCGCAAGTGCGCCAGTGAAAGAGTAACGGAAGAGCGCAGGTGCGTTCAAGCGGAATCTGTCGCAGTAGGCTATTTCGA
GAGACGGGTTCCAACCTCAAAACGTGCAGACGTGCGTACTTGCTAAGGAGTGGACACTGGGGGTATCGATACCCCTACCTCCCGCATGCGAAGCGGGCGC
TCAGGGTGCGAGAGGTCCCGGATTCGATCTCCGGCAAGGCCCAGCCCGTTGCCGATCATACCGGAAGAGTGATTACGGTATGCCTCGCTACAGGCGCATC
CGTAACAGTGATGAAACGTGTAGGAGGAATTTCCTATACACTGATAGAAGTCCAATACGATGATGACTTCATCGTCTTGGACTTAAATGATAAATTTGAT
GTTATCCTTGGTTTACCGTGGCTCAAAAGGTACAAGCCACAAGTCAGCTGGCATCGACGAAGTGTCGATATACCCGCCGCTTGTTCACCAGACGACCATA
TAATGAACGTCTTGGAGCGTCCACCACCATGTGGATGTACTACGAGTGAGTGCGATGGCCTCACGTGTGGTTCGGTCGTTAGTACGACTGCACAAGATTA
CAATATGACTAACCATCATATTGCGGAGCAAGAATTCGGCGACTGCATAACAATGCAGGAAGTGCTGAAGGTCCACCTCTCGAATAAGTCGAGCGGACCG
GGGCATGATTGCATCCTTAATAGACAACACCCAGATTGTGACCGACCGATTGCGAATGATGGTCAATACGGAGACGAATAGCCCAAGAGGCTAGCGTTGA
GGGAATAAGTCTCCAACAAACAGTGGAAGTAAGTTCTTATGAGATGACAGAGACATTGAATGTCCTGGTTAATGACGGATCAAGAATAGGTAGCCATATG
CTTGATCTGATCCGCCTCCGAAGCTGACTTCGGAGATCTATCAGTTACCCCCGCTGAACCAAAAGAGGTTTTTGCGTGATCTGCGTAGTGGCAAAGTCAA
GCAGATCTGCGTACTCGTCGCGGGGGATGAGTAAGTCAGTGATATCCGATAAGCAATGATCTTTGCCGAAGATGGACGAGTTTTTAGTAACTCATCAATG
GACGGAAGTGTCCTTGATGAAGAGACTCGAGTGTACTTGATGAAAAGACTCGAATTGAGCGATATACATCCCAAACGTGGGAATCGCTCAGAACAAATCC
TCTCTACGATGATTTATTGGAATTCAGGGATGTATTCCCAGAAGCAGTCCCGTGCGAGTTACCTAAGAACAAAGGTACTCGTCACGAATTCAACCTGAAA
CCGAGTTCGAAGTACTGTGTCATGAAGCAATGGCCACTGCTCGTGAACAAGTACTAGCGATCGACAAATTCTTTGCAGATCACTTAGCAGCCGGCCGTGT
GAGGGATTCCACCTCTCCACATAGCTCTCCGACCTTCTGTGTGCGAAAGGTCACAGGTGGATGGCTGATAGTACACGTCTTCAACAAGTTGAATGCTGCC
ACTGTACCGGCTCAAACACCAATATCAAGAAAAGATGTGATCATAGATGGTATGGCTAAGAGTATTATCTTTTCATCCATGGATCTGATGGATGGGTTCT
ATCAGATCCTTATGCGCAAAAGGGACATTCCCTATACTGCAGTGAGAACCCCAAGCGGTATGCTTTGGAAGGAGTTAGTAATGCCACAAGGGCTAAGTAA
TGCCCCTGCCACATTCAATAGATGTGCGGCGAATCTATTAAGATCGGTAAGAGTGTTCGCGCCCATTTACTTCGATGATGTATTCTTCAATAGCCGGGCT
TTGGATGAACAGACGGATGTGGAAGTGCACCGACTCCACTTCCGAAAAGTTCTACACACTAATGCGCAAGCATAAGTTGTACGCCAACCTCAAGAAGTGT
ATATTTGCTGCTAACGAAGTACCACTTCTTGGTTTCATCGTGGGCAAGCATGGCGTCCGGCCCGATCCAGAAAAGATCAAGGCGATCGCCGTCTGGCCGG
TGCCTACAGATTTCAAGGGACTTCATAATTTACTTGGCCTAGCGGCGTATTTGCATAAATATTCGCGCAATTACGCCGAGATGACTGTTCATCTCTCTCG
TTTATTGGAAAAGAACGAGAAGTGGGAATGGAGTTCCGACTGCCAGCGCTCATTCGAAGGTATCAAGCAAAGCTTGATACGATCGCCAGTTTTGGTAATT
GCAGACTAAGACAGGCTATTTCACGTGGTCTGTGATTCCAGTGACTTTGCAATAGGCTGTGCATTAATGCAATACGATGCAGACGATGCGGAGAGTGTCG
TCCGTTACCAGTCACGCCAGCTGCAACTAGCTGAACGCAACTACCCCGTCTATGACAAGGAACGCCTTGACCTGAAGTACGCGCTGGCTAAGTTCAGAGT
CTATCTGCTAGGTGATAGACCCTTCATCGTTTATACGGACCATGCGTCTTGACGCACGGCCGTAAACAGTCCACACCACTCGCACGGATGGCGGGGTGGA
TGTAATTCTTTGTGAAGTATAACTTCTTCGTCGAGTATAAGCCAGGACGACTTAACGTCGTCGCTAACGCACTCTCGTGCCGGCCCGATTTCGAGCCGGC
TGCGCCACCTAACACTGGTTCGACCACTGTCGCGGTACTGACTTCGGTTGTCCTGTCGTCAACATATTTTGGAAGACATAAGAAAGGAGTATGACCCGGG
AATGGTGCGATTGATGCATCATCTCTCGCACCCACCCGGGAAGAGCCTCAAACAGTTGTCTTCAGTATATGGATCCTCTATGAATAGATACACAGTTCGC
AACGGCAACTCTAATATTCGGCCTTTTCACGGCGACACACGTCGTGTCGCCAGATCATGGTGATCTGCGAATGCGTACCATGTATGAGTACCACGACGCA
CCTGCTGGTGGACATCGTGGTCGTGAGAAAACATATCTCACATTGAGCCGCCACTTTCACTGGCCTCGCCACTATCGGTTCGTGCGCAAGTACGTTCGGG
CCTGTGAGTTCCGTCAATGGGTGGAATCTAGTCCTTACCTTCGAGCCCCGTTGCAACCTCTGCCCGTCCCGGCCGAGTGCTGGGAATCCGTCCCAATGGA
CTTTGTCTTTGAATTCTCCGCAGACTCTCACAAGAATACTGGTATTCTTGTGTTCGTTGACAGGTTCAGCAAGATGGTACATCTGGTTGCTGTAATCGAA
TCAATCAACGCATCGGCTTGTGCCCGTGTCATTATCCACACGGTATTTCTGCTTCATGGGTTGCCTCGTGAAATCGTGTCTGATTGGGACCCGCGCTTCA
CAGCTGATTTCTAGCGTTCCGTGTTCAAAACACTCGGAACACGCTTAAAGATGTCGACCTCTGACCATCCCGAAACAGATGGTCCGAACGCGCTTATCGT
GTCCTCGGAGAGAGCCTTCGAGGGTACATCCATTCCTTTACGAGTTGGAGCGAATTGCTGCCGATGGTGGAGTGCGTCATCAACAATATAGTCCATGCAT
CGACGACGCACACACCGTTCTTCGTGAATGGCGTACGCCATCCACGTCTTCCCGCCTTTTTAGAGTGTGACTCTTGCTTAAGGGGGGACTCATTCGAGCG
ACCGTCAATCTGGCTCTCACTCGTCAAGTGCTGACAATGCGGTCACCACTTTCGACGCCGATGTCGATCACATCGACTTTGGTGAAGAAGAAGAAAGTAA
GAGCATGCCCTTGCTGGCCACGATACTGATCAAATCAGAATCACGCCTAGTGCAACCAAAAGACACACTCACAGAGGTGATCTTGCTACAGTATGCTCTA
ATAGCACTGCAGATAAAGACAGCGAGTCAGAAGATGAGTTCAGACTGGATCGTGATACGGTTGTCAGTTTCGTACAAGACTCTCTCGCAGAGGTGGTAGA
TCGACAAAAACGAAACGGTGACAAGAATGGAAGGGAAATGTTCTTTTATTCAATAAAGGAGACTTAGTCCTACTATCTACGGTTGACCTACCTTGACACA
TAGTGACTAACGTGGGTAGTAACAAGTTACTACCCAAGTTTATCGGTCCATTTCGTGTGCTACGCCGCCTAGGCAACGCATATACGATTGAACTGCCACG
TAAGATGCACACGCATCCTACATTCTACGTCGGTCTCCTTAGGCCGTACTAACAGTGCGGGGCTTCTTCCAGTGA