Description :
From Genome Similarity Track
Location :
Scaffold_1774:2617- 3855
Transcript NameFunction/comments
Phyra_87283reverse transcriptase

Sequence
1238 bases(100 bases per row)
GCGAGGATCGGAGCTGGCGCGCGGCACACTGCCGCGCGATGACCAGGCTTTCCGCAGCGGAAAAAAATCAGCGAGAGGTCATTCTGACCACCGCGGCCTC
TCCCAGAGGACGACCACCGTCAATTCTGCGAAGCCTCGATCGCATCGATCTCCATTGGCTCGGGTACCGACACCCGAGTCTGCGCAGGCATCCTCTTGGC
GTATGACGACGTCACCAGGTAGTCCTCGCGTAGCGCGAGAGCAAAGGCTTCTTCCAACGTGGCAGGATCGGCGCGCGTGATACAGTACCGCGTCATACCT
TCGCACATACCAAACACAAAGACATGGACTTGGGAAGCCATGTCGATCGACTTCGTGACGGTACACGATGCAAGGTGTCGCGTTCTCTGGACGTAGTCGC
GCATGGTCATCTTGCCTTGCTTTAGGGCGAAGAATGTAGCTCGAACGCGCGACTCATCCTGCGGTGGTTCGAAGGCGAGACGCAGGTCGCTCTGGAGTGC
CTCCAGAGTCGGGAACGCGTACTGGTCGACGACAAGTTTGCCGAGAGCCCATTCTTTGGCCTTTCCGGACAAACGGGAAAGCAAGAAGTTCACCTTGGCT
GACGGCGCCTCGATTAGCCTCGAGGCGATCGCGATGTCGATCTCTCTGAACCAGCGATTCAGAGGTAGGCGATCAGGACCCTCGCCAGAATAGGAGGGTG
TCTCCATCTTGACGGCATTGTTCCTAGACGCATGCGAGGGAGTTGATACTCGCCGTTTTGCTTCGGCGAGCTCGCGGTCCATGAACTCTTGGATGGCTTG
GCGCTGTTGGTCGGGGGTCGCTGAGCTCAGCAGCGACGTGACGACGGTTTCTCCGGACACCGCCGCGAGGCGGTGCAACGCTTGCCACTCGATAGACGTG
AGATGGGGGAAGGCCGCGTGTTCCAGGGTCATCACTGGAGGTCCGGCGGGCTGGTCTTCACTCATCTCGAACTTGGTCATGGGAAGGACTACAAAGTGCT
ACCAGGTGTAACGGGCCAGGTGAGTGCCCGTCACAAGCATACACGTAGCGGTGAGGAAGCGTCCAATAAGCTCAGGTATACTGAGACCAAGTGTTTAGTC
TAGGGTAAAATCAACTCTGTTTTATTATTGGGACCGGGGCGGGTGGCCCTCGGATCCATGTGAACCACTCAAATGCAGGTCGATACCTGATTGATCGAAA
TGGGTCTGGCTCCCCACTTTCAACCAATCACAGGATGA