Description :
From Genome Similarity Track
Location :
Scaffold_1178:2617- 3708
Transcript NameFunction/comments
Pytap_DAOMBR444snap-pag1_scaffold_1178-abinit-gene-0.7Mitogen-activated protein kinase

Sequence
1091 bases(100 bases per row)
AATCGCAGCGGTGTAGTGCAGACAGTTTAGCATGATCTCTGGGGCCCGATACCAACGAGTCACTACGTATTCCGTAAGCTCgTGCGGCTGGGAGTTAGCA
ACTCTTGTTGCATCCAACTCTGGGTCCATGCCTCCTCGCGCGAGCCCGAAATCACATAtCTTCAGATCACAGTTGGAATTGAGGAGAATATTGCTAGGCT
TCATGTCACGATGGAGTACGCCAGCAGAGTGAATATGATACagCGCGCAAAGCATTTGGTACAGAAAATACTTGACGTGGTCATCTGACATGGGTTGCAT
CGAGTAGATCACCTGATGAAGATCGGTTTCCATCAACTCAGTAATAATATACATGTCTTCGAACGTCTTCTTGGTTgCCGGGGgTGCCAAATCGAGTAGT
TGGGTGATGTTCTTATGATGAAAGTGGCGAAGGAGACGGACTTCGCGAAGGATCCGTTTAGCGTCAACTAAGTCGTCGAAAATGTTGGTGATCTTTTTGA
TGGCGACGCTCATGTCTGCTAATGAATCTTTAGCTGCAATGACGGCACCGTATGCCCCATTTCCGATTGACTTGAGAAGCCCATATCGCACGTCCAATGT
GAAAACTTGACCATTTGAGGTGAAGGTATGCACCTGGGGGCGAATTACTCCACTAAATCGAGTGTTCGAAGCTTGATGAAACTGCTGTTGGAGGTACCTG
CTTCTATCTGACGAAGTAGGAGGGGTCTTTGGTGACGGAGGTGTACCAACGCGGTCTGCGGTATCCAATGAAGCCGCTGTCATTGCAGACGCCACACCTG
CGAtCACAGCATCTTCATCTTCTGCTTCTTCCGTCTTTTCTTCAAAATGATTGAATGATCCATCCGATCGCCTATAAGGTGAGGGCGTTGATGCGACAGA
GTTTGTCCCACTCGGAGAAGCAGCATGCATTGACGTCGCCGCAAATACTATCTGATCAAGCTCAGTTGGAGATGTGCATTCGCTAAGACGTCTCGCAAAT
GCTGCATGTTCGGTGTCTTCCTCGTCTTCGAATTGATTGCTGCTGCGATGCTCATTATTGTTGTCTTCGCTTCCGTACTCGCTTTCATCTC